Split (2)

train · 8.99k rows

text stringlengths 35 171k
It also highlights that the interaction among several disciplines, such as environ- mental/chemical engineering, biotechnology, mineralogy, chemistry and microbial ecology lays the foundation for a new type of approach for solving problems through efﬁcient recovery solutions. 5. Conclusions This study evaluated the biological and chemical possibilities regarding the extraction of metals from crystalline diopside-bearing slag and its amorphous counterpart. The ele- ments bound in sulﬁdes, intermetallic compounds and glass were extracted much easier than those contained in diopside. The leaching sequence delineated here can be stated as follows: sulﬁdes (sphalerite > chalcopyrite) > intermetallic phases > glass > diopside. Citric acid was found to improve extraction rates as compared to A. thiooxidans -mediated leaching. If the use of a bacterially-mediated method is intended, it is evident that either lower pulp density or extension of bioleaching time has to be considered. Slags eventually revealed a potential for Zn recovery, whereas recovery of Cu and Pb from this material is rather unsuitable. The use of the proposed methods for this material at an industrial scale would be economically unproﬁtable. The original material after treatment was partially depleted in metals, but it was not possible to remove Pb completely from this waste that disqualiﬁes its potential for use in construction or agriculture sectors. This study provides impor- tant insight into the dissolution of diopside bearing and glassy slags and is relevant to development of suitable treatment of slags to mitigate their environmental ﬁngerprint. Supplementary Materials: The following are available online at [URL] 63X/11/3/262/s1, Figure S1: Two weeks long leaching of elements from diopside-bearing slag as a function of pulp density, Figure S2: Two weeks long leaching of elements from glassy slag as a function of pulp density. Author Contributions: Conceptualization, A. P. ; Funding acquisition, A. P. ; Investigation, B. M. , M. N. , A. P. ; Methodology, M. N. , B. M. , A. P. ; Data curation: A. P. , B. M. ; Visualization, B. M. , A. P. ; Writing—original draft, A. P. ; Writing—review and editing, B. M. All authors have read and agreed to the published version of the manuscript. Funding: This work was ﬁnancially supported by the National Science Centre (NCN) in Poland in the frame of the SONATA program under grant agreement UMO-2018/31/D/ST10/00738 to A. P. Acknowledgments: The authors thank Jakub Kierczak (Uniwersytet Wrocławski) for his valuable advice given on this work. The authors would also like to gratefully acknowledge time devoted by Editors and Reviewers in evaluating this work as well as their valuable comments and remarks. Conﬂicts of Interest: The authors declare no conﬂict of interest. Minerals 2021 ,11, 262 17 of 19 References 1. Radetzki, M. Seven thousand years in the service of humanity-the history of copper, the red metal. Resour. Policy 2009 ,34, 176–184. [Cross Ref] 2. Bellemans, I. ; De Wilde, E. ; Moelans, N. ; V erbeken, K. Metal losses in pyrometallurgical operations—A review. Adv. Colloid Interface Sci. 2018 ,255, 47–63. [Cross Ref] [Pub Med] 3. Ettler, V. Soil contamination near non-ferrous metal smelters: A review. Appl. Geochem. 2016 ,64, 56–74. [Cross Ref] 4. Tyszka, R. ; Pietranik, A. ; Kierczak, J. ; Ettler, V. ; Mihaljevic, M. ; Weber, J. Anthropogenic and lithogenic sources of lead in Lower Silesia (Southwest Poland): An isotope study of soils, basement rocks and anthropogenic materials. Appl. Geochem. 2012 , 27, 1089–1100. [Cross Ref] 5. Tyszka, R. ; Pietranik, A. ; Kierczak, J. ; Zieli ´ nski, G. ; Darling, J. Cadmium distribution in Pb-Zn slags from Upper Silesia, Poland: Implications for cadmium mobility from slag phases to the environment. J. Geochem. Explor. 2018 ,186, 215–224. [Cross Ref] 6. Piatak, N. M. ; Seal, R. R. Mineralogy and environmental geochemistry of historical iron slag, Hopewell Furnace National Historic Site, Pennsylvania, USA. Appl. Geochem. 2012 ,27, 623–643. [Cross Ref] 7. Ettler, V. ; Legendre, O. ; Bodenan, F. ; Touray, J. -C. Primary Phases and Natural Weathering of Old Lead Zinc Pyrometallurgical Slag from Pribram, Czech Republic. Can. Mineral. 2001 ,39, 873–888. [Cross Ref] 8. Parsons, M. B. ; Bird, D. K. ; Einaudi, M. T. ; Alpers, C. N. Geochemical and mineralogical controls on trace element release from the Penn Mine base-metal slag dump, California. Appl. Geochem. 2001 ,16, 1567–1593. [Cross Ref] 9. Piatak, N. M. ; Seal, R. R. Mineralogy and the release of trace elements from slag from the Hegeler Zinc smelter, Illinois (USA). Appl. Geochemistry 2010 ,25, 302–320. [Cross Ref] 10. Kierczak, J. ; Pietranik, A. Mineralogy and composition of historical Cu slags from the rudawy janowickie mountains, Southwestern Poland. Can. Mineral. 2011 ,49, 1281–1296. [Cross Ref] 11. Tyszka, R. ; Kierczak, J. ; Pietranik, A. ; Ettler, V. ; Mihaljeviˇ c, M. Extensive weathering of zinc smelting slag in a heap in Upper Silesia (Poland): Potential environmental risks posed by mechanical disturbance of slag deposits. Appl. Geochem. 2014 ,40, 70–81. [Cross Ref] 12. Lottermoser, B. G. Mobilization of heavy metals from historical smelting slag dumps, north Queensland, Australia. Mineral. Mag. 2002 ,66, 475–490. [Cross Ref] 13. Ettler, V. ; Johan, Z. ; Kˇ r íbek, B. ; Šebek, O. ; Mihaljeviˇ c, M. Mineralogy and environmental stability of slags from the Tsumeb smelter, Namibia. Appl. Geochem. 2009 ,24, 1–15. [Cross Ref] 14. Fomchenko, N. ; Uvarova, T. ; Muravyov, M. Effect of mineral composition of sulﬁdic polymetallic concentrates on non-ferrous metals bioleaching. Miner. Eng. 2019 ,138, 1–6. [Cross Ref] 15. Kaksonen, A. H. ; Lavonen, L. ; Kuusenaho, M. ; Kolli, A. ; Närhi, H. ; Vestola, E. ; Puhakka, J. A. ; Tuovinen, O. H. Bioleaching and recovery of metals from ﬁnal slag waste of the copper smelting industry. Miner. Eng. 2011 ,24, 1113–1121. [Cross Ref] 16. Liu, R. ; Mao, Z. ; Liu, W. ; Wang, Y. ; Cheng, H. ; Zhou, H. ; Zhao, K. Selective removal of cobalt and copper from Fe (III)-enriched high-pressure acid leach residue using the hybrid bioleaching technique. J. Hazard. Mater. 2020 , 121462. [Cross Ref] [Pub Med] 17. Muravyov, M. I. ; Fomchenko, N. V. ; Usoltsev, A. V. ; Vasilyev, E. A. ; Kondrat’Eva, T. F. Leaching of copper and zinc from copper converter slag ﬂotation tailings using H 2SO4and biologically generated Fe 2(SO 4)3. Hydrometallurgy 2012 ,119, 40–46. [Cross Ref] 18. Warchulski, R. ; Gaw˛ eda, A. ; K ˛ adziołka-Gaweł, M. ; Szopa, K. Composition and element mobilization in pyrometallurgical slags from the Orzeł Biały smelting plant in the Bytom–Piekary ´Sl ˛ askie area, Poland. Mineral. Mag. 2015 ,79, 459–483. [Cross Ref] 19. Kupczak, K. ; Warchulski, R. ; Dulski, M
[URL] 22. Hallberg ZF, Wang XC, Wright TA, Nan B, Ad O, Yeo J, Hammond MC (2016) Hybrid promiscuous (Hypr) GGDEF enzymes produce cyclic AMP-GMP (3', 3'-c GAMP). Proc Natl Acad Sci U S A 113(7):1790-1795. [URL] 23. Nelson JW, Breaker RR (2017) The lost language of the RNA World. Sci Signal 10(483). [URL] 24. Sudarsan N, Lee ER, Weinberg Z, Moy RH, Kim JN,Link KH, Breaker RR (2008) Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science 321 (5887):411-413. [URL] 25. Kellenberger CA, Wilson SC, Hickey SF, Gonzalez TL, Su Y, Hallberg ZF, Brewer TF, Iavarone AT, Carlson HK, Hsieh YF,Hammond MC (2015) GEMM-I riboswitches from Geobacter sense the bacterial second messenger cyclic AMP-GMP. Proc Natl Acad Sci U S A 112(17):5383-5388. [URL] 26. Kellenberger CA, Wilson SC, Sales-Lee J, Hammond MC (2013) RNA-based fluorescent biosensors for live cell imaging of second messengers cyclic di-GMP and cyclic AMP-GMP. J Am Chem Soc 135(13):4906-4909. [URL] 27. Nelson JW, Sudarsan N,Phillips GE, Stav S,Lunse CE,Mc Cown PJ,Breaker RR (2015) Control of bacterial exoelectrogenesis by c-AMP-GMP. Proc Natl Acad Sci U S A 112 (17):5389-5394. [URL] 28. Li F, Cimdins A, Rohde M, Jansch L, Kaever V, Nimtz M, Romling U (2019) Dnc V synthesizes cyclic GMP-AMP and regulates biofilm formation and motility in Escherichia coli ECOR31. m Bio 10(2):e02492-e02418 29. Burroughs AM, Zhang D, Schaffer DE, Iyer LM, Aravind L (2015) Comparative genomic analyses reveal a vast, novel network of nucleotide-centric systems in biological conflicts, immunity and signaling. Nucleic Acids Res 43(22):10633-10654. [URL] gkv1267 30. Whiteley AT, Eaglesham JB, de Oliveira Mann CC, Morehouse BR, Lowey B, Nieminen EA, Danilchanka O, King DS,Lee ASY, Mekalanos JJ, Kranzusch PJ (2019) Bacterial c GAS-like enzymes synthesize diverse nucleotide signals. Nature 566(7743), 259-263. doi:[URL] 10. 1038/s41586-019-0953-5 31. Margolis SR, Wilson SC, Vance RE (2017) Evolutionary origins of c GAS-STING signaling. Trends Immunol 38(10):733-743. [URL] 32. Bose D (2017) c GAS/STING pathway in cancer: Jekyll and Hyde story of cancer immune response. Int J Mol Sci 18(11). [URL] 33. Chen Q, Sun L, Chen ZJ (2016) Regulation and function of the c GAS-STING pathway of cytosolic DNA sensing. Nat Immunol 17(10):1142-1149. [URL] 34. Tan X, Sun L, Chen J, Chen ZJ (2018) Detection of microbial infections through innate immune sensing of nucleic acids. Annu Rev Microbiol 72:447-478. [URL] micro-102215-095605 35. Gao D, Wu J, Wu YT, Du F, Aroh C,Yan N, Sun L, Chen ZJ (2013) Cyclic GMP-AMP synthase is an innate immune sensor of HIV and other retroviruses. Science 341 (6148):903-906. [URL] 36. West AP, Khoury-Hanold W, Staron M, Tal MC, Pineda CM, Lang SM, Bestwick M, Duguay BA,Raimundo N, Mac Duff DA, Kaech SM, Smiley JR, Means RE, Iwasaki A, Shadel GS (2015) Mitochondrial DNA stress primes the antiviral innate immune response. Nature 520 (7548):553-557. [URL] 35Microbial Cyclic GMP-AMP Signaling Pathways 623 37. Zhang X, Shi H, Wu J, Zhang X, Sun L, Chen C, Chen ZJ (2013) Cyclic GMP-AMP containing mixed phosphodiester linkages is an endogenous high-affinity ligand for STING. Mol Cell 51 (2):226-235. [URL] 38. Woodward JJ, Iavarone AT, Portnoy DA (2010) c-di-AMP secreted by intracellular Listeria monocytogenes activates a host type I interferon response. Science 328(5986):1703-1705. [URL] 39. Burdette DL, Monroe KM, Sotelo-Troha K, Iwig JS, Eckert B, Hyodo M, Hayakawa Y, Vance RE (2012) STING is a direct innate immune sensor of cyclic di-GMP. Nature 478 (7370):515-518. [URL] 40. Gao P, Ascano M, Zillinger T, Wang W, Dai P, Serganov AA, Gaffney BL, Shuman S, Jones RA, Deng L, Hartmann G, Barchet W, Tuschl T, Patel DJ (2013) Structure-function analysis of STING activation by c[G(2',5')p A(3',5')p] and targeting by antiviral DMXAA. Cell 154 (4):748-762. [URL] 41. Mc Farland AP, Luo S, Ahmed-Qadri F, Zuck M, Thayer EF, Goo YA, Hybiske K, Tong L, Woodward JJ (2017) Sensing of bacterial cyclic dinucleotides by the oxidoreductase RECON promotes NF-kappa B activation and shapes a proinflammatory antibacterial state. Immunity 46 (3):433-445. [URL] 42. Kranzusch PJ, Wilson SC, Lee AS,Berger JM, Doudna JA,Vance RE (2015) Ancient origin of c GAS-STING reveals mechanism of universal 2',3' c GAMP signaling. Mol Cell 59 (6):891-903. [URL] 43. Mc Farland AP, Burke TP, Carletti AA, Glover RC,Tabakh H, Welch MD,Woodward JJ (2018) RECON-dependent inflammation in hepatocytes enhances Listeria monocytogenes cell- to-cell spread. MBio 9(3). [URL] 44. Ryjenkov DA, Simm R, Romling U, Gomelsky M (2006) The Pil Z domain is a receptor for the second messenger c-di-GMP: the Pil Z domain protein Ycg R controls motility in enterobacteria. J Biol Chem 281(41):30310-30314. [URL] 45. Amikam D, Galperin MY (2006) Pil Z domain is part of the bacterial c-di-GMP binding protein. Bioinformatics 22(1):3-6. [URL] 46. Jones CJ, Utada A, Davis KR, Thongsomboon W, Zamorano Sanchez D, Banakar V, Cegelski L, Wong GC, Yildiz FH (2015) C-di-GMP regulates motile to sessile transition by modulating Msh A Pili biogenesis and near-surface motility behavior in Vibrio cholerae. PLo S Pathog 11(10):e1005068. [URL] 47. Almblad H, Harrison JJ, Rybtke M, Groizeleau J, Givskov M, Parsek MR, Tolker-Nielsen T (2015) The cyclic AMP-Vfr signaling pathway in Pseudomonas aeruginosa is inhibited by cyclic di-GMP. J Bacteriol 197(13):2190-2200. [URL] 48. Chen ZH, Singh R, Cole C, Lawal HM, Schilde C, Febrer M, Barton GJ, Schaap P (2017) Adenylate cyclase A acting on PKA mediates induction of stalk formation by cyclic diguanylate at the Dictyostelium organizer. Proc Natl Acad Sci U S A 114(3):516-521. [URL] 1073/pnas. 1608393114 49. da Costa Vasconcelos FN, Maciel NK, Favaro DC, de Oliveira LC, Barbosa AS, Salinas RK, de Souza RF, Farah CS, Guzzo CR (2017) Structural and enzymatic characterization of a c AMP-dependent diguanylate cyclase from pathogenic Leptospira species. J Mol Biol 429 (15):2337-2352. [URL] 50. Luo Y, Zhao K, Baker AE, Kuchma SL, Coggan KA, Wolfgang MC, Wong GC, O'Toole GA (2015) A hierarchical cascade of second messengers regulates Pseudomonas aeruginosa sur- face behaviors. MBio 6(1)
Journal of Environmental Management 250 (2019) 109502 Contents lists available at Science Direct Maviranmental Journal of Environmental Management ELSEVIER journal homepage: www. elsevier. com/locate/jenvman Research article Ni and Cu recovery by bioleaching from the printed circuit boards of mobile phones in non-conventional medium Check for Mahdokht Arshadi, Sheida Nili, Soheila Yaghmaei* Chemical and Petroleum Engineering Deparment, Sharif University of Technology,Tehran, Iran ARTICLEINFO ABSTRACT Keywords: There is a substantial volume of mobile phone waste every year. Due to the disadvantages of traditional methods, Bioleaching it is necessary to look for biological processes that are more eco-friendly and economical to recover metals from Mobile phone PCBs e-waste. Fungi provide large amounts of organic acids and dissolve metals but using sucrose in the medium is not Penicilum simplicissimum economical. In this paper, the main objective is to find a suitable alternative carbon substrate instead of sucrose Non-conventional medium for fungi bioleaching of Ni and Cu in printed circuit boards (PCBs) of mobile phones using Penicillium simpli- Metal recovery cissimum. Four kinds of carbon sources (including sucrose, cheese whey, sugar, and sugar cane molasses) were selected. Also, p H and number of spores in inoculum were optimized by response surface methodology (RSM) for all carbon sources. The results showed the simultaneous maximum recovery of Cu and Ni is not possible. For Cu recovery, sugar is the best economical and simplistic medium instead of sucrose. Maximum recovery of Cu (90%) gained at the p H of 7, 3. 3 × 107 spores, and in sugar. The amount of Ni recovery (89%) was highest in molasses, at the p H of 2, and 10° spores. The results proved non-conventional carbon sources improve bioleaching effi- ciency and the possibility of industrialization. 1. Introduction enough efficient and environmental friendly in every situation (Vera et al. , 2013). Physical and chemical technologies consume high energy, Waste of electronic and electric instruments (e-waste) has the they are expensive, and some of the chemicals produced agents influ- highest rate of growth in the world; the bulk part of the residues pro- ence the environment negatively (Veit et al. , 2006). duces in developing countries. E-waste contains dangerous and precious Biotechnological leaching processes which are more eco-friendly, metals simultaneously like As, Pb, Cu, Ni, Au, Ag, Pd, Pt, etc. (Islam and economical, and doesn't require specialized labors than other chemical Huda, 2019; Marra et al. , 2018). Recent researches show that the methods have been used to recover valuable metals from e-waste amounts of mobile phone wastes grow exponentially. It is reported that (Faraji et al. , 2018; Marra et al. , 2018). there are more than 4. 57 billion users of the mobile phone around the In the bioleaching process, organic or inorganic acids produced by world since 2017 (Bauer et al. , 2019) and the average life expectancy of microorganisms (including bacteria or fungi) solute metals (Auerbach mobile phone reduced from 2. 9 years in 2011 to 2. 21 years in 2018 (Liu et al. , 2019). Compared to bacteria, fungi can tolerate toxic materials et al. , 2019). In the latest reports, estimated that at the end of 2015, more; they have a shorter lag phase and faster leaching rate. Fungal more than 7 billion mobile phones used worldwide. Around 10 million bioleaching has four main mechanisms: (1) acidolysis (the principal kilograms of them are discarded yearly. The e-waste contains about mechanism) in which by producing the organic acids, metals dissolve in 50% of plastics and different metals like gold, silver, copper, nickel, and mentioned acids; (2) complexolysis where the metals make complexes iron. The concentration of Au and Ag within PCBs is more than ten with produced organic or amino acids; (3) redoxolysis in which organic times rather than natural ores (Arshadi et al. , 2018b). acids reduce the metals; and (4) bioaccumulation in which the myce- Most of the used metals in mobile phone wastes can be reused and lium acts as a sink for the metal ions (Faraji et al. , 2018; Mirazimi et al. , recycled using different physical, chemical, and biological methods. Old 2015). By the formation of metal complexes, the toxicity of metal re- manual divesting techniques like mechanical treatment (such as duces. Aspergillus and Penicillum are the most used heterotrophic fungi crushing and jigging), hydrometallurgical, and pyrometallurgical in recovering of heavy and worth metals from solid wastes because they methods have been used to recover e-waste. These methods result in a can provide large amounts of organic acids (citrate, gluconate, and high recovery of valuable metals (Ren et al. , 2014). But they are not oxalate) (Faraji et al. , 2018). * Corresponding author. E-mail address: [EMAIL] (S. Yaghmaei). [URL] Received 28 May 2019; Received in revised form 15 August 2019; Accepted 31 August 2019 0301-4797/ 2019 Published by Elsevier Ltd. M. Arshadi, et al. Journal of Environmental Management 250 (2019) 109502 Bioleaching methods divide into three categories including (1) one- medium is an important strategy to make production economically vi- step bioleaching, in which fungus is inoculated to the medium with able (Salari et al. , 2019). solid waste, (2) two-step bioleaching, in which the solid waste adds to Molasses is a cheap carbon source and a food industry by-product in the medium when the fungus is in its logarithmic growth phase, (3) the proces of sugar beet or cane production (Sun et al. , 2019). The spent-medium bioleaching, in which the fungus is in the stationary composition of molasses varies depending on the quality of the raw phase; the highest level of organic acids in the medium provide and product. Considering the high sucrose content of the molasses, it would then the solid phase is added to the biomass (Mirazimi et al. , 2015). seem to be a natural alternative to synthetic media for P. simplicissium Choosing an effective method depends on the type of substrate and also growth and metabolite production (Gojgic-Cvijovic et al. , 2019). Sun the selected microorganism (Amiri et al. , 2011). Several physical, et al. (2019) showed the economical production of some metabolites chemical, and biological variables affect the bioleaching process (such using molasses (Sun et al. , 2019). Cheese whey is the byproduct of the as carbon and nitrogen source, oxygen supply, p H, temperature, in- cheese production with high biochemical oxygen demand. Cheese whey oculation content, and etc. ). These parameters have to be optimized to contains about 55% of nutrients in the original milk supports the me- reach the maximum amount of recovery. p H is one of the main para- tabolite production in microbial fermentation (Salari et al. , 2019). meters in the bioleaching process (Muddanna and Baral, 2019). Some Sugar has a similar composition to sucrose; it is not pure and contains researchers attend to fungal bioleaching of metals from solid waste galactose too. utilized Aspergillus niger and P. simplicissimum as the most effective It is noteworthy that the application of fungal bioleaching in solid microbes. In a first reported attempt, Brandl et al. (2001) used these waste is limited; there are a lot of gaps in this field. In our knowledge, fungi to recover metals from e-waste. The microbial growth was in- too limited research was found to study bioleaching of e-waste using P. hibited in a higher pulp density of 10 g/l. During the six weeks of the simplicissimum. Especially using sucrose in the medium is not econom- adaptation phase, fungi grew at a concentration of 1oo/l. Both fungi ical. Finding an appropriate substitution instead of sucrose is one of the mobilized Cu and Sn by 65%, Al, Zn, Pb, and Ni more than 95% from e- essential aims of industrializing this biological method (Gojgic-Cvijovic waste (Brandl et al. , 2001). et al. , 2019). Xia et al. (2018) aimed to study the feasibility of recovery of metals In this research, extraction of Ni and Cu from mobile phone wastes from e-waste by mixed fungal cultures in the stirred tank reactors. At using P. simplicissimum fungi was investigated. The aim of this study the first step, the fungi adopted to 80 g/l of the e-waste sample. At the was to find the optimized conditions for growing P. simplicissimum end of the bioleaching process, community structure analysis proved fungus in industrial medium (including sugar cane molasses, cheese that A. niger (28%) and Purpureocillium lilacinum (72%) were the two whey, and sugar) before the medium scale in the laboratory (bio- dominated fungal species. About 56% of Cu, 20% of Pb, 15. 7% of Al, leaching in bioreactors) and comparison to the principal medium of P. 49% of Zn, and 8% of Sn were recovered (Xia et al
was less when compared to lower p H values (Fig. 2a). Metal recovery from LIB during the bioleaching process generally In contrast, the redox potential decreases as the pulp density happens by acid dissolution, but the presence of an oxidizing agent increases. In the first two days of bioleaching, a sharp reduction in such as H2O2 or Fe3+ ions will reduce the acid intake (Meshram Eh occurred at higher pulp densities above 20 g/L. After two days, et al. , 2015; Niu et al. , 2014). the redox potential increased continuously, because of the bio- The protons (H+) attack the oxygen atom of Li Co O2, followed by leaching process as well as the oxidation of Fe2+ ions into Fe3+ hydrolysis due to protonated oxygen atoms that detach the metals during bacterial growth at low pulp densities (Fig. 2b). At high pulp from battery powder. When the Fe. + ions are oxidized by densities 40, 70, and 100 g/L of LIB powder, however, the Eh A. ferrooxidans to Fe3+ ions to gain the energy, the formation of increased slightly or remained constant after two days, confirming biogenic ferrous ions reduces the insoluble Co3+ ions into soluble that the bacteria were less active and no more bioleaching Co2+. This reaction happened via “the oxidative attack of Fe+3 ion happened. During the bioleaching process, the metal dissolution of on the reductive dissolution of Co+3" (Mishra et al. , 2008). The LIBs goes through a different oxidation-reduction process, which dissolution of cobalt and lithium also occurs during the bioleaching alters due to the variation in leaching solution compositions. Redox process is related to their sulfate formation (Xin et al. , 2009). potential is one of the crucial and controlling factors in bioleaching However, the formation of sulfate intermediates of cobalt and by the ferric sulfate oxidation process (Cordoba et al. , 2008; lithium initiated by the sulfur metabolism of A. ferrooxidan sup- Sandstrom et al. , 2005; Klauber, 2008; Li et al. , 2013). The redox ports the dissolution of metals in the leaching solution (Eqn. (7) - couple Fe3+ /Fe2+ will show the oxidation/reduction potential (ORP) (13)) (Xin et al. , 2009; Weijin et al. , 2019). of the bioleaching systems, in which high ORP indicates a high concentration of Fe3+ ions in the medium. 2Fe2+ + 1/2O2 + 2H+ → 2Fe3+ + H20 (7) The changes in ferric ion concentration during the bioleaching process is an important parameter that shows the biological ac- 4Li Co O2 + 12H+ → 4Li+ + 4Co2+ + 6H20 + O2 (8) tivity of A. ferrooxidans. In the first three days of bioleaching, the ferric ion concentration dropped sharply for pulp densities from Fe2+ + Li Co O2 + 4H+ → Fe3+ + Co2+ + Li+ + 2H20 (9) 5 g/L to 100 g/L due to the attack of ferric ions in the culture me- dium on the metals of the LIB powder; therefore, there is a decline Li2O + 2H+ → 2Li++ H20 (10) in the ferric ions during the leaching process. After three days, the Fe3+ ions in the medium were constant for the remaining days for Fe2+ + Co3+ → Fe3+ + Co2+ (Co O) (11) pulp densities 5 g/L to 20 g/L, which indicates to be the bacteria is still active (Fig. 2c). This result indicates the bacteria could tolerate Co O + 2H+ → Co2++ H20 (12) the pulp density up to 20 g/L. For high pulp densities above 20 g/L, the Fe3+ concentration reached below 0. 5 g/L within one day. It can 2Fe SO4 + 2Li Co O2 + 4H2SO4 → be understood that the presence of the bacteria at high pulp den- Fe2(SO4)3 + 2Co SO4 + Li2SO4 + 4H20 (13) sities 40 g/L to 100 g/L did not have any activity because they could not tolerate the metal toxicity that has been leached out into the The goal of LIB bioleaching is the process optimization by solution. Jarosite formation during the A. ferrooxidans growth also increasing the pulp density to get higher metals recovery. Maxi- utilizes the Fe3+ ions for the complex (Daoud and Karamanev, mizing the metal recovery would be more cost-effective when 2006). working with high pulp densities because the reactor volume needed for bacterial culture production (bio-lixiviants) were 3. 3. 1. Metalextractionfrom LIBs smaller when compared with low pulp densities. In addition to During the bioleaching process, cobalt and lithium reactor cost, the growth nutrient and other convenience costs S JJ. Roy, S. Madhavi and B. Cao Journalof Cleaner Production280(2021）124242 Table 1 Leaching effciency of Cobalt and Lithium from LIB with pulp density 100 g/L after bioleaching with A. ferrooxidans by three cycles of replenishing bacterial culture produced by modified 9K media with different concentration of Fe SO4 compared with the control (modified 9k media with different conc. of Fe SO4). Pulp density of LIB powder Bacteria/Media Fe SO4 1st 2nd 3rd Total In Modified leaching leaching leaching %Leaching 9K Media 24 h% 24 h% 24 h% 72 h 100 g/L Acidithiobacillusferooxidans 45 g/L Co: 22. 76 ± 0. 19 10. 32 ± 0. 19 7. 53 ± 0. 13 40. 61 Li: 19. 33 ±0. 06 13. 94 ± 0. 02 9. 65 ± 0. 02 42. 92 Control (media) 45 g/L Co: 17. 22 ± 0. 28 8. 09 ± 0. 37 3. 82± 0. 02 29. 13 Li: 16. 39 ±0. 06 10. 01 ±0. 17 7. 50 ± 0. 01 33. 90 100 g/L Acidithiobacillusferooxidans 90 g/L Co: 35. 75 ± 0. 42 14. 53 ± 0. 23 4. 32 ± 0. 04 54. 59 Li: 29. 11 ± 0. 11 17. 56 ± 0. 10 7. 94 ± 0. 01 54. 61 Control (media) 90 g/L Co: 16. 68 ±0. 19 8. 99 ± 0. 32 3. 58 ± 0. 16 29. 25 Li: 15. 23 ±0. 09 9. 24 ± 0. 23 7. 88± 0. 07 32. 35 100g/L Acidithiobacillusferrooxidans 150 g/L Co: 45. 24 ± 0. 31 33. 06 ± 0. 40 15. 72 ± 0. 04 94. 02 Li: 28. 48 ± 0. 40 21. 70 ± 0. 04 10. 12 ± 0. 01 60. 30 Control (media) 150 g/L Co: 16. 06 ± 0. 06 8. 73 ± 0. 04 6. 85 ± 0. 02 31. 64 Li: 13. 88 ±0. 02 7. 15 ± 0. 01 5. 29 ± 0. 01 26. 32 Table 2 Leaching efficiency of Cobalt and Lithium compared with H2SO4 and Fe3+ concentration, when a different dosage of Fe SO4 used in the modified 9K media for A. ferooxidans growth. Pulp density of LIB Fe SO4 in Modified Fe3+ Conc. (g/L) H2SO4 Conc. (M) Total % Total % powder 9K Media Cobalt Leaching Lithium Leaching 3 cycles of Replenishing 3 cycles of Replenishing 100 g/L 45 g/L 14. 96 ± 1. 39 0. 17 ± 0. 01 44. 51 42. 92 100 g/L 90 g/L 25. 46 ± 1. 97 0. 30 ± 0. 02 54. 59 54. 61 100 g/L 150 g/L 36. 86 ± 2. 10 0. 52 ± 0. 01 94. 02 60. 30 p 1200 1200 L G L-Li Co O2 1000 1000 L G G-Graphite 800 800 600 600 400 400 200 200 15 25 36 46 56 66 76 15 25 36 46 56 66 76 2Theta 2Theta C d 1200 1200 1000 1000 800 800 600 600 400 200 200 15 25 36 46 56 66 76 15 25 36 46 56 66 76 2Theta 2 Theta Fig. 4. XRD analysis of original LIB powder of particle size <100 μm before and after bioleaching with different A. ferrooxidans culture media with different H2SO4 and Fe3- concentrations. a) LIB powder b) Modified 9K media (45 g Fe SO4) c) Modified 9K media(90 g Fe SO4) d) Modified 9K media( 150 g Fe SO4). would be lower at high pulp densities with higher leaching eff- 3. 3. 2. Replenishing of bacterial culture ciency (Thompson et al. , 2017)
describe, these efforts can be organized into a three- tiered hierarchy of modeling goals (Figure 1c): 1) Sequence-to-function goals, which seek to understand Sequence-to-function models for ML-driven relationships between nucleic acid (NA) sequences of design of genetic parts individual genetic parts and their effect on circuit The most fundamental level of functional encoding for a behavior; 2) Composition-to-function goals, which focus genetic element (e. g. , a promoter) is its NA sequence,. on learning how combinations of genetic parts work which determines both its physiochemical properties Current Opinion in Biomedical Engineering 2024, 31:100553 www. sciencedirect. com Machine Learning to Accelerate Synthetic Biology Rai et al. 5. and interactions with other molecular species (e. g. , More recent studies have focused on using ML to binding to a TF). Decoupling the contributions that explore NA sequence design for genetic elements features of an NA sequence make to these properties is explicitly intended for synthetic circuit construction [63-65] (Figure 2b). In one notable study, data from a challenging for biophysical models [39] and has moti- vated application of ML to create predictive sequence-. library of ~10' RNA toe-hold switches were used to to-function mappings for different categories of genetic train an MLP model to predict fold-change expression elements. These efforts were predicated on the wide- between repressed and activated switch configurations. spread availability of next-generation sequencing significantly outperforming regression-based models (NGS) technology, primarily the Illumina platform [40], that rely on biophysical parameterization [66]. In another piece, expression measurements from >105 which has emerged in the past two decades as a primary workhorse for generating large-scale datasets for funda- bacterial RBSs were measured and used to train a CNN- Res Net model to predict expression with high accuracy mental regulatory processes including transcription [41-43], translation [44,45], epigenetic regulation [46], [67]. The use of a DNA recombinase-mediated activity and chromatin accessibility [47,48] (Figure 2a). Seminal assay enabled time series measurements across their li- work applying ML models to these datasets has pro- brary and led to less noisy data and greater model ac- vided deep insight into relationships between NA curacy. In more recent work, activity measurements of a sequence and evolved regulatory grammar [49-52] and, 280k-member library of 75 bp human 5' UTRs were used to train a CNN to predict effects on tuning critically, demonstrated an important ML scaling prin- transgene reporter expression in human cells [68]. A ciple: parallel increases in NGS training dataset size and ML model complexity can yield higher predictive follow-up to this work expanded the model's capabil- power. Examples highlighting this principle include Sei, ities, training on ~200k shorter length sequences (25 and 50 bp) to learn cell type-specific expression [69]. a large deep NN trained on >22,000 Ch IP datasets across >1,300 cell types [53]. Sei accurately classifies enhancer sequences and predicts the effects of muta- A number of reports have appeared over the last year tions on cell type-specific expression activity. More describing the use of data from both native and syn- recently, Avsec and colleagues developed Enformer. thetic sequences to train models of varied size, featu- [54], a transformer LM trained on >7,000 genomic and rization, and accuracy (Figure 2c). One standout is the Ch IP datasets that is capable of integrating features recently reported Evo (Figure 2c, bottom), a versatile across long (>100 kb) length scales (e. g. , long-range regulatory model trained on >20 million prokaryotic genomes that can make functional predictions for a chromatin effects and DNA accessibility. range of tasks across DNA, RNA, and protein expression landscapes [70]. Like Enformer, Evo was developed as While these studies demonstrate that highly predictive. an early-generation foundation model: a large model (in excess of 10' parameters) trained across diverse datasets models can be trained on native genomic sequence diversity, the development of massively parallel re- using significant computational power. Foundation porter assays (MPRAs)-an approach enabled by ad- models can be appropriated as community resources to vances in low-cost DNA synthesis-has facilitated use. achieve a variety of goals, potentially including assisting gene circuit design, as we discuss below. of non-native sequence libraries to train models that predict activity for elements ranging from promoters The studies described in this section demonstrate the [55,56] and enhancers [57,58], to UTRs and introns feasibility of using HT biological data to train highly [59,60] (Figure 2b). In one notable study, data from a predictive sequence-to-function ML models for. ~30M-member library of 80 bp enhancer sequences different genetic part categories, and offer a new strat- tested in yeast were used to train a transformer model to predict promoter activity [61]. The model predicted egy for generating registries of systematically tuned how enhancer mutations can "evolve" new, program- functional variants for each category-an activity that has med expression activities. Following a similar approach been historically carried out using random mutagenesis to decipher TF regulatory grammar in mammalian cells, and selection approaches. Importantly, they also reveal Sahu and colleagues measured diverse (>10) syn- key technical and logistical considerations for devising thetic enhancer libraries (50-170 bp in length) and ML-based projects. First, NA composition and overall used the data to train logistic regression and CNN library diversity should align with the prediction task. Probing underdetermined design spaces may require models, revealing that TFs regulate promoters in an. additive manner with weak motif grammar, consistent large, diverse libraries that prioritize coverage, while with a billboard model of gene regulation [57]. Taken elements containing well-characterized sequence together, these studies have demonstrated the ability motifs can permit more targeted diversification. Model of ML models to explore non-native sequence choice and feature selection are closely coupled with these considerations. While model classes that use bio- design space to not only program artificial regulatory physically consistent feature selection can offer mech- activity, but to gain insight into native regulatory function [62]. anistic explanations of circuit behavior [55,62], higher www. sciencedirect. com Current Opinion in Biomedical Engineering 2024, 31:100553 6 v SI: Synthetic Signaling and Engineering Cell Therapy Figure 2 MODELS TRAINED ON PUBLICDATASETS Training Feature Genetic element/ Model Training Prediction goal Accuracy Ref. data source diversity class selection part category Chip. TF inding one hetd genomic sequence predict chromatin profiles and No S a tses ents. I Zhou 2015 coding sequence variant in human cells Dnase HS sequence enehetd predict chro (Re Cet) AUPRC Avsec 2021 loci regulated by pluripotency factors sequence lict tissue-specific chromatin profile Chi P: TF binding AUROC = CNN tissue specific mutationsd 2 x10 57 hrom. serarks encodec NGS datasets (1D conv) Zhou 2018 one hot predict cell type-specific expression Chi P: TF binding, CNN 2. 1 10 NGS AUROC Dnase HS >1,300 cell typ dil. conv. ) 5. 3 X 10 human, Chi P: TF binding promoters, enhancers gene expression activity across AUROC= gen. sequence segments 1. 6 X 102 mo Transforme encodec 0. 7-0. 9 Avsec2021 ATACseq, DNAse HS >10cell types organisms and cell types Chen2022 Avsec2021 Transformer CNN INPUTS OUTPUTS INPUTS OUTPUTS ACTO human >T binding, Thbindinaies senomis genomic sequences nouse acccessiblity activity one-hot fully ne-hot self layer's a tenion encode layers b MODELS TRAINED ON MPRA DATASETS predicomotersequence 2. 2 x10 bacterial promoters energyfro =0. 80 (60-120 bp) ene hed 9. 1 X 10 MLP riboswitches flow-seq =0. 43 (148 bp) TF binding 1 X 10 predict expression from non-linear = 0. 92 flow-seq pronobers eerneeees from sequence in yeas 1X10 ssion activity from predict expres yeast promoters 1 x 1ers (1DCov) ereedee promoter sequences flow-seq yeast promoters CNN =0. 79 Kotopka2020 240-320 bp) in yeas sequence cell type-specific CRE predict transcript. activity in different 7. 8 X 10 CNN =0. 5 Gosai 2023 RNA-seq cell types from enhancer CREs encoded enhancer (2D Conv) 0. 65 in human cells (200 bp) DNA recorde 2. 7 X 10 sionactivity enceded bacterial RBS =0. 93 Hollerer 2020 RBSvariants (Res Net) ine. coli sequence expressior (18 bp) 2. 8 X 10 ene det (2D Conv) human 5UTRs UTRs = 0. 93 Sample 2019 profiling by NGS 50 bp) NND encoded (2D Conv) 60 = 0. 62 sequence predict expression activity from logistic TF binding humanenha AUPRC = STARR-seq and GREs ~9X10 Sahu2022 , one ho (50-500 bp) ed sec one hot oredict expression activity (3 ) = 0
067 d−1, 1. 24 and 0. 61 , respectively. Figure 9 shows the fitted curves on the experimental data of the conversion X(U) vs time. Also, Fig. 9 shows that the model with [ Fe3+]0. 61 has better fitting than the model with (Fe3+/Fe2+)0. 5, proving direct relation between uranium column bioleaching and [Fe3+]. Fig. 9 Experimental data under optimum conditions and kinetic model of uranium bioleaching in column with F(C)=[Fe3+]0. 61 and (Fe3+/Fe2+)0. 5 Based on the previous investigation, the kinetics equation of uranium bioleaching in column with R2=0. 99 can be written in the following form: 3 0. 61 4. 17( ) 1 (1 0. 016 [Fe ] )t X t t   (12) H. ZARE TA V AKOLI, et al/Trans. Nonferrous Met. Soc. China 27(2017) 2691 −2703 2702 4 Conclusions The column bioleaching of uranium ore by indigenous strain of Acidithiobacillus ferrooxidans was carried out to investigate the optimum condition for enhancing uranium recovery. The four significant parameters (initial ferrous ion concentration, p H, aeration rate and inoculation percent) were selected for further optimization by applying Plackett −Burman design. Afterwards, these four factors were optimized via CCD as, [Fe2+]initial =2. 89 g/L, aeration rate 420 m L/min, p H 1. 45 and inoculation percent (v/v) 6%. The confirmation experiment approved the highest extraction of uranium under optimal conditions as 90. 27%. ANOV A results showed that the most effective factor for uranium recovery was initial ferrous ion concentration and the less effective factor was inoculation percent. A couple of statistically significant interactions are derived between [Fe2+]initial and inoculation percent as well as aeration rate and inoculation percent. The analysis of the uranium ore bioleaching residue under different conditions confirmed the formation of K-jarosite on the surface of minerals. By using optimal conditions uranium bioleaching recovery increased at column and jarosite precipitation was minimized. The kinetic model for uranium column bioleaching is expressed as ()Xt 3 0. 61 4. 171 (1 0. 016 [Fe ] ) ,t t which is consistent with experimental results. Acknowledgments The authors thank the Tarbiat Modares University & Nuclear Science and Technology Research Institute for their financial support. References [1] GILLIGAN R, NIKOLOSKI A N. The extraction of uranium from brannerite —A literature revie w [J]. Minerals Engineering, 2015, 71: 34−48. [2] GHORBANI Y , BECKER M, MAINZA A N, FRANZIDIS J P , PETERSEN J. Large particle effects in chemical/biochemical heap leach processes a review [J]. Minerals Engineering, 2011, 24: 1172 −1184. [3] GHORBANI Y , BECKER M, PETERSEN J, MAINZA A N, FRANZIDIS J P. Investigation of the effect of mineralogy as rate-limiting factors in large particle leaching [J]. Minerals Engineering, 2013, 52: 38− 51. [4] TUOVINEN O H, HSU C J. Effect of p H, iron concentration, and pulp density on the solubilisation of uranium from ore material in chemical and microbiological acid leach solutions: Regression equation and confidence band analysis [J]. Hydrometallurgy, 1984, 12: 141 −149. [5] ABHILASH, PANDEY B D. Role of ferric ions in bioleaching of uranium from low tenor Indian ore [J]. Canadian Metallurgical Quaterly, 2011, 50(2): 102 −112. [6] FOWLER T A, HOLMES P R, CRUNDWELL F K. On the kinetics and mechanism of the dissolution of pyrite in the presence of Thiobacillus ferrooxidans [J]. Hydrometallurgy, 2001, 59: 257 −270. [7] HO E M, QUAN C H. Iron(II) oxidation by SO 2/O2 for use in uranium leaching [J]. Hydrometallurgy, 2007, 85: 183 −192. [8] AHONEN L, TUOVINEN O H. Bacterial leaching of complex sulfide ore samples in bench-scale column reactors [J]. Hydrometallurgy, 1995, 37: 1− 21. [9] ACEVEDO F. Present and future of bioleaching in developing countries [J]. Electronic Journal of Biotechnology, 2002, 5(2): 52−56. [10] MALIK A, DASTIDAR M G, ROYCHOUDHURY P K. Factors limiting bacterial iron oxidation in biodesulphurization system [J]. International Journal of Mineral Processing, 2004, 73: 34 −42. [11] DREISINGER D. Copper leaching from primary sulfides: Options for biological and chemical extraction of copper [J]. Hydrometallurgy, 2006, 83: 10 −21. [12] PRADHAN K C, NATHSARMA K, SRINIV ASA R, SUKLA L B, MISHRA B K. Heap bioleaching of chalcopyrite: A review [J]. Minerals Engineering, 2008, 21: 355 −362. [13] MELLADO M E, CISTERNAS L A, GÁLVEZ E D. An analytical model approach to heap leaching [J]. Hydrometallurgy, 2009, 95: 33−42. [14] GUAY R, SILVER M, TORMA A E. Ferrous iron oxidation and uranium extraction by Thiobacillus ferrooxidans [J]. Biotechnology and Bioengineering, 1977, 19: 727 −740. [15] JUNIOR O G. Bacterial leaching of uranium ore from Figueira-PR, Brazil, at laboratory and pilot scale [J]. FEMS Microbiology Reviews, 1993, 11: 237 −242. [16] MUNOZ J A, BLASQUEZ M L, BALLESTER A, GONZALEZ F. A study of the bioleaching of a Spanish uranium ore. Part III: column experiments [J]. Hydrometallurgy, 1995, 38: 79 −97. [17] QIU G Z, LI Q, YU R, SUN Z H, LIU Y , CHE M, YIN H, YANG Z H, YI L L, XU L, SUN L, LIU X. Column bioleaching of uranium embedded in granite porphyry by a mesophilic acidophilus consortium [J]. Bioresource Technology, 2011, 102: 4697 −4702. [18] ABHILASH, MEHTA K D, KUMAR V , PANDEY B D, TAMRAKAR P K. Column bioleaching of a low grade silicate ore of uranium [J]. Mineral Processing and Extractive Metallurgy Review, 2010, 31: 224 −235. [19] ABHILASH, PANDEY B D, SINGH A K. Comparative performance of uranium bioleaching from low grade Indian apatite rock in column and bioreactor [J]. Energy Procedia, 2013, 39: 20 −32. [20] ZARE TA V AKOLI H, ABDOLLAHY M, AHMADI S J, KHODADADI DARBAN A. The effect of particle size, irrigation rate and aeration rate on column bioleaching of uranium ore [J]. Russian Journal of Non-Ferrous Metals, 2017, 58(3): 188 −199. [21] KARAMANEV D G, NIKOLOV L N, MAMATARKOV A V. Rapid simultaneous quantitative determination of ferric and ferrous ions in drainage waters and similar solutions [J]. Minerals Engineering, 2002, 15: 341 −346. [22] MONTGOMERY D C. Design and analysis of experiments [M]. New York: John Wiley and Sons, 2008. [23] ARSHADI M, MOUSA VI S M. Multi-objective optimization of heavy metals bioleaching from discarded mobile phone PCBs: Simultaneous Cu and Ni recovery using Acidithiobacillus ferrooxidans [J]. Separation and Purification Technology, 2015, 147: 210−219. [24] BOUFFARD S C. Understanding the heap biooxidation of sulfidic refractory gold ores [D]. Vancouver: University of British Columbia, 2003. [25] FINKELESTEIN N P, NEEDED C R S, NICOL M J. An electrochemical model for the leaching of uranium dioxide [C]// National Institute for Metallurgy. Johannesburg (South Africa): IAEA, 1972. H. ZARE TA V AKOLI, et al/Trans. Nonferrous Met. Soc. China 27(2017) 2691 −2703 2703 [26] BURKIN A R. Chemical hydrometallurgy: Theory and principles [M]. London: Imperial College Press, 2001
Experimental data (left) is represented as blue dots with error bars and the fitted model is represented as the yellow trace. Residuals of the fit (right) is also shown. S33 Curve-fitting Residuals P1-BA(5) (metal) 0. 0 Polymer excluded volume model 10-1 10-1 Q(A-1) Q(A-1) P6-HA (metal) 0. 3 0. 2 0. 1- 0. 0 10 -0. 2 Polymer excluded 10 -0. 3 volume model -0. 4 - 10-1 10-1 Q(A-1) Q(A-1) P5-c HA (metal) 0. 6 0. 4 0. 2 0. 0- -0. 2 -0. 4 Polymer excluded -0. 8 - volume model -1. 0 10-1 10-1 Q(A-1) Q(A-1) P8-LA (metal) Polymer excluded volume model 10- Q(A-1) Q(A-1) Figure S48. Fitting of the polymer excluded volume model to small-angle scattering (SAXS) profiles of polymer dissolved to 2. 5 mg/m L in buffer (40 m M MES, 100 m M KCl, p H 6) with 0. 1 [Eu3+]/[AA]. Experimental data (left) is represented as blue dots with error bars and the fitted model is represented as the yellow trace. Residuals of the fit (right)is alsoshown. S34 Block 1 Block 2 Block3 b1 Target DP (NIPAM) 49 0 49 Target DP (n BA) 0 15 0 Target DP (t BA) 38 NIPAM added (mmol) 3. 857 o 2. 151 n BA added (mmol) 0 0. 766 0 t BA added (mmol) 0 1. 940 0 CTA added (μmol) 78. 7 Macro CTAadded(umol)a 51. 1 43. 9 AIBN added (umol) 3. 9 2. 6 2. 2 (macro)CTA / AIBN 20 20 20 1,4-dioxane added (m L) 1. 930 1. 022 1. 485 Total volume (m L) 1. 930 1. 416 1. 485 Table S4. Synthesis of b1 block copolymer. quantity calculated using Mn calculated from 'H NMR of block copolymer intermediate and the mass of macro(CTA) used in the extension reaction. b2 Block 1 Block2 Block3 Target DP (NIPAM) 24 50 24 Target DP (n BA) 1 8 Target DP (t BA) 19 19 NIPAM added (mmol) 1. 889 3. 666 1. 484 n BA added (mmol) 0. 551 0 0. 495 t BA added (mmol) 1. 496 0 1. 175 CTA added (μmol) 78. 7 Macro CTAadded(mmol)a 73. 3 61. 8 AIBN added (umol) 3. 9 3. 7 3. 1 (macro)CTA/ AIBN 20 20 20 1,4-dioxane added(m L) 1. 670 1. 921 1. 937 Total volume (m L) 1. 970 1. 921 2. 18 Table S5. Synthesis of b2 block copolymer. a quantity calculated using Mn calculated from 1H NMR of block copolymer intermediate and the mass of macro(CTA) used in the extension reaction. b1 b2 Block 1 NIPAM (DP) 45. 7 21. 3 n BA(DP) 0 5. 8 t BA (DP) 0 15. 3 % conversion (NIPAM) 95. 8 94. 8 % conversion (n BA) 0 93. 4 % conversion (t BA) 92. 1 Block 2 NIPAM (DP) 0 42. 6 10. 1 n BA (DP) 0 t BA (DP) 25. 8 0 % conversion (NIPAM) 0 92. 0 % conversion (n BA) 92. 1 % conversion (t BA) 92. 2 Block 3 NIPAM (DP) 37. 2 20. 9 n BA (DP) 0. 1 6. 7 t BA (DP) 0. 2 15. 4 % conversion (NIPAM) 89. 3 90. 6 % conversion (n BA) 100 92. 3 % conversion (t BA) 100 90. 2 Table S6. Summary of 'H NMR data for block copolymer synthesis. Monomer DP were calculated by subtracting the monomer alkene of a post-polymerization crude sample from a pre-polymerization sample; NIPAM (5. 51 ppm) n BA (5. 87 ppm), t BA (6. 05 ppm). S35 Mn Mw D B1 5550 5870 1. 06 B2 10290 11150 1. 08 B3-postcapping 14490 16410 1. 13 Table S7. summary of organic phase SEC data for the synthesis of block copolymer b1. Molecular weights are calculated relative to PEG calibration standards (1,100,000-238 Da). Mn Mw D B1 5750 6100 1. 06 B2 10460 11230 1. 07 14850 16740 B3-postcapping 1. 13 Table S8. summary of organic phase SEC data for the synthesis of block copolymer b2. Molecular weights are calculated relative to PEG calibration standards (1,100,000-238 Da). OC NC dioxane H2)11CH g b,c acetone water 47. 7 3. 0 0 8. 5 8. 07. 57. 06. 56. 0 8 (ppm) Figure S49. Pre-polymerization 'H NMR for the first block of b1. Integrations are set relative to the methyl group, i. (600 MHz, acetone-d6). S36 dioxane acetone CH2)11CH water g,h b,c 2. 0 3. 0 0 7. 5 7. 0 6. 5 6. 0 5. 5 5. 0 4. 5 4. 0 3. 5 1. 5 1. 0 0. 5 8 (ppm) Figure S50. Post-polymerization H NMR for the first block of b1. Integrations are set relative to the methyl group, j. (600 MHz, acetone-d6). b,c f,g dioxane acetone (CH2)11CH3 b,c,f,g d,i,n,o,p water 10. 9 28. 0 3. 0 4. 0 8（ppm Figure S51. Pre-polymerization 'H NMR for the second block of b1. Integrations are set relative to the methyl group, q. (600 MHz, acetone-d6). S37 dioxane acetone d. i. n. o. b,c,f,g 0. 9 2. 2 3. 0 8. 5 8. 0 7. 5 7. 0 6. 0 5. 5 5. 0 4. 5 4. 0 3. 5 3. 02. 52. 01. 5 1. 00. 5 Figure S52. Post-polymerization 'H NMR for the second block of b1. Integrations are set relative to the methyl group, q. (600 MHz, acetone-d6). b，c h,i 1,m dioxane acetone b,c,h,i,l,m NC (CH2)11CH3 water 6. 3 16. 6 22. 4. 0 8. 0 7. 5 7. 0 6. 5 6. 0 5. 0 4. 0 3. 5 3. 0 2. 5 1. 0 0. 5 8（ppm） Figure S53. Pre-polymerization 'H NMR for the first block of b2. Integrations are set relative to the methyl group, s. (600 MHz, acetone-do). S38 h， dioxane acetone j,o,q,r,s (CH2)11CH water b,c,h,i,l,m Ik a d 0. 4 1. 3 1. 2 0 8. 5 7. 5 7. 0 6. 5 6. 0 5. 5 5. 0 4. 5 4. 0 3. 5 2. 0 1. 5 1. 00. 5 6 (ppm) Figure S54. Post-polymerization 'H NMR for the first block of b2. Integrations are set relative to the methyl group, t. (600 MHz, acetone-do). b,c (CH2)11CH3 dioxane acetone b,c e,g h,j,k,l,m water 46. 3. 0 8. 0 7. 5 7. 0 6. 0 5. 5 5. 0 4. 5 4. 0 3. 02. 52. 0 1. 0 0. 5 8 (ppm) Figure S55. Pre-polymerization 'H NMR for the second block of b2. Integrations are set relative to the methyl group, n. (600 MHz, acetone-d6). S39 dioxane acetone (CH2)11CH3 h,j,k,l,m b,c e,g water 3. 0 8. 5 7. 0 6. 5 6. 0 5. 5 4. 5 4. 0 3. 0 2. 5 2. 0 1. 5 05 Figure S56. Post-polymerization 'H NMR for the second block of b2. Integrations are set relative to the methyl group, n. (600 MHz, acetone-d6). NC HO DMSO m,n,f 26. 1 69. 4 93. 7 12512011. 511. 010. 510. 09. 59. 08
These deﬁned or partially deﬁned microbial communities are exposed to various growth conditions and contaminants to promote tolerance to more extreme conditions that may be encountered in some mineral processes or contaminated sites, with the ultimate goal of enhancing biomining and bioremediation efﬁciency. A summary of natural and deﬁned mixed microbial consortia used for enhanced biomining and remediation purposes are outlined in Table 2. Genes 2018 ,9, 116 16 of 28 Table 2. Examples of enhanced biomining consortia and their design purposes Microbial community members Natural/Deﬁned Design Purpose Reference Leptospirillum sp. (MT6), Acidimicrobium ferrooxidans, Acidithiobacillus caldus, Alicylobacillus sp. (Y004), Sulfobacillus spp. , Ferroplasma sp. (MT17)Deﬁned Reduced jarosite production during chalcopyrite leaching with sulfuric acid produced by sulfur oxidation. [204] A. ferrooxidans and Acidophilium acidophilum Deﬁned Heterotrophic removal of inhibiting organic compounds produced during microbial growth. [206] Leptospirillum MT6 and A. caldus and the heterotroph Ferroplasma sp. MT17 Deﬁned Increased acid production. [205] A. ferrooxidans ATCC 23270, A. thiooxidans DSM 622, L. ferrooxidans DSM 2391, L. ferriphilum DSM 14647 and A. caldus S2Deﬁned Improved attachment to mineral surfaces. Leptospirillum attachment promoted the secondary attachment if A. caldus on the surface of pyrite. [207] Two strains A. ferrooxidans isolated from the coal mine. Natural isolates Increased growth and improved leaching rates. [209] A. thiooxidans A01, A. ferrooxidans (CMS), L. ferriphilum (YSK), A. caldus (S1), Acidiphilium spp. (DX1-1), F. thermophilum (L1), S. thermosulﬁdooxidans (ST)Deﬁned Increased growth and improved leaching rates by the introduction of a non-indigenous species to the consortium constructed from indigenous isolates. [210] A. ferrooxidans ATCC 23270, A. thiooxidans (mesophilic) A. caldus ,L. ferriphilum (moderately thermophilic)Deﬁned Improved leach yields by promoting growth of moderate thermophiles. [208] Uncharacterised environmental salt tolerant, iron and sulfur oxidising enrichment cultures mixed with various mesophilic, moderately thermophilic and thermophilic pure cultures obtained from culture collections. Mix of natural consortia and deﬁned cultures Improve salt tolerance with naturally occurring microbes enriched from salty and acidic environments. [12] Genes 2018 ,9, 116 17 of 28 Systems biology can be used to systematically understand diverse physiological processes of cells and their interactions and to optimally design synthetic microbial consortia for any given process [ 211]. Engineering cell-to-cell interactions and communications is at the heart of engineering synthetic communities and optimising biomining of mineral ores [ 212]. Exopolymeric substances (EPS) play a key role in in biofilm formation [ 213], and for biomining microbes, the biofilm allows for direct attachment of cells to the mineral surface and the formation of a microenvironment that favours leaching [ 214]. Several studies have shown that biofilm formation in biomining environments is crucial for interspecies communication [ 215] and vice versa [ 21,216,217]. However, further characterisation of the interactions and communication between species within a biomining microbial consortium is required to facilitate engineering new and exciting microbial consortia with novel and industrially relevant functionality. In addition to engineering the genomes and the interactions and communication between species within a microbial consortium, it is possible to engineer the environment to compliment ﬁne tuning for community composition, activity, and function [ 197,218]. An example of this was demonstrated by Li et al. , [ 219], whereby bioﬁlm formation was enhanced by modifying one or multiple growth variables to promote the initial attachment of Sulfobacillus thermosulﬁdooxidans and continuous bioﬁlm development on pyrite. Similar methodologies could be undertaken to ﬁne tune the growth and activity of engineered microbial communities for biomining processes. Research has been limited to the transformation of pure cultures, including species within the genera Acidithiobacillus and Sulfolobus [ 51,61]. Generally speaking, the efﬁciency of transformation for these extremophiles is very low, and further work dedicated to developing methods for the generation of stable transformants, and improving transformation efﬁciency is required. Brune and Bayer [198] and Rawlings and Johnson [ 220] both stated that while it could be possible to improve efﬁciency and yields of bioleaching and biooxidation using engineered microbial consortia, factors such as competition with native microbes, stability of transformed species and engineered communities, process sterility, process conditions, and other regulatory requirements would determine the practicability at industrial-scale. It is likely that maintaining and controlling engineered microbial communities within a non-ideal and non-controlled environment, such as a bioleaching heap or open vat reactor, would be difﬁcult, and the ability to characterise and engineer all complex interactions would be close to impossible. However, as more work is undertaken to fully elucidate the complete microbial diversity in these unique environments and their interactions, the rational design for microbial consortia engineering and overall efﬁciency of biomining and other associated processes of remediation and waste management could possibly be improved. 3. Conclusion Synthetic and computational biology have the potential to improve the traits of naturally existing microorganisms so they can be productively implemented in biomining and other industrial processes. For acidophiles, the development of genetic tools has lagged behind the developments for other microbes. The delay has not been due to a lack of interest in these microorganisms, but rather a reﬂection of the difﬁculties in establishing such a system. In combination with the comprehensive genome-enabled stoichiometric modelling studies, it should be feasible to design genetically engineered microorganisms with higher bioleaching activity, leading to an overall increase in the efﬁciency of biomining processes. Nevertheless, likewise with the other ﬁelds, the applications of GMOs in mining industries would be signiﬁcantly enhanced by the support of regulatory agencies in developing a safe implementation of the technology. Acknowledgments: Funding received from CSIRO Synthetic Biology Future Science Platform and CSIRO Land and Water is gratefully acknowledged. The authors thank Dr Ka Yu Cheng and Dr Carol Hartley from CSIRO for reviewing the manuscript. Author Contributions: Y. G. wrote a large part of the manuscript; N. J. B. , H. K. , V. S. , R. P. C. and A. H. K. contributed to various sections of the manuscript. Conﬂicts of Interest: The authors declare no conﬂict of interest. Genes 2018 ,9, 116 18 of 28 References 1. Kaksonen, A. H. ; Boxall, N. J. ; Usher, K. M. ; Ucar, D. ; Sahinkaya, E. Biosolubilisation of metals and metalloids. In Sustainable heavy metal remediation ; Rene, E. R. , Sahinkaya, E. , Lewis, A. , Lens, P. N. L. , Eds. ; Springer International Publishing: Cham, Switzerland, 2017; Volume 1, pp. 233–283. 2. Kaksonen, A. H. ; Mudunuru, B. M. ; Hackl, R. The role of microorganisms in gold processing and recovery– A review. Hydrometallurgy 2014 ,142, 70–83. [Cross Ref] 3. Coker, J. A. Extremophiles and biotechnology: Current uses and prospects. F1000Research 2016 ,5. [Cross Ref] [Pub Med] 4. Kaksonen, A. H. ; Sarkijarvi, S. ; Peuraniemi, E. ; Junnikkala, S. ; Puhakka, J. A. ; Tuovinen, O. H. Metal biorecovery in acid solutions from a copper smelter slag. Hydrometallurgy 2017 ,168, 135–140. [Cross Ref] 5. Bryan, C. G. ; Watkin, E. L. ; Mc Credden, T. J. ; Wong, Z. R. ; Harrison, S. T. L. ; Kaksonen, A. H. The use of pyrite as a source of lixiviant in the bioleaching of electronic waste. Hydrometallurgy 2015 ,152, 33–43. [Cross Ref] 6. Kaksonen, A. H. ; Boxall, N. ; Bohu, T. ; Usher, K. ; Morris, C. ; Wong, P. ; Cheng, K. Recent advances in biomining and microbial characterisation. Sol. St. Phen. 2017 ,262, 33–37. [Cross Ref] 7. Kaksonen, A. H. ; Morris, C. ; Hilario, F. ; Rea, S. M. ; Li, J. ; Usher, K. M. ; Wylie, J. ; Ginige, M. P
This phenomenon was attributed to the increase of arsenic concentration in the pregnant leaching solution (PLA), which subsequently became inhibitory to the strain. Similarly, Park and Cho [ 49] leached valuable metals from mine waste by column experiments at room temperature. They satisfactorily leached Cu and iron from the ore. Also, the synergy between bioleaching and electrochemical processes has been proven to be successful to recover metals from mine tailings. Lee et al. [ 50] revealed that the removal speed of an integrated process of biological leaching and electrokinetics was around 2. 5 times faster than that obtained in independent processes. Similarly, Park et al. [ 51] obtained Cu recoveries of approximately 98% after applying electrowinning to the PLA obtained by biological means which is signiﬁcantly higher than the 78% obtained by acid leaching. Minerals 2016 ,6, 128 7 of 21 The research within bioleaching of mine tailings demonstrated that this technology is an actual alternative to traditional methods, such as cyanide leaching, to recover metals from mine tailings and mitigate implicit environmental issues. Our research shows that the studies are mainly focused on determining the optimum operating conditions for the process in ﬂask and column experiments. The importance and inﬂuence of bacterial shape and adaptation in the process were also underlined by the scholars who presented their ﬁndings in Korean journals. Table 2. Bioleaching research of mine tailings according to the parameters studied and recoveries achieved as well as microorganisms used in the studies. The articles appear in chronological order. Author(s) Microorganism(s) Parameters p H Particle Size Time (Day) Leaching (%) [50] Ind. bacteriaa Bioleaching/electrokinetics 10–12 2000m 29 As: 64. 5 [44] A. thiooxidans Mineral source 2. 0 177m 20 - [42] Ind. bacteriaa Bacterial attachment 3. 5 841m 20 - [49] Ind. bacteriaa Leaching feasibility 4. 2 +2000 m 22 - [40] Ind. bacteriaa Attachment 3. 5 841m 50 - [41] Ind. bacteriaa Attachment 3. 5 841m 80 - [45] Ind. bacteriaa Bacterial adaptation 2. 82 1 mm 42 - [47] A. ferrooxidans Surface pretreatment 1. 5 10–10 mm 20 Cu: 72 [51] A. ferrooxidans Bioleaching/electrokinetics 2 4 cm 13 Cu: 76 [48]A. thiooxidans and A. ferrooxidans Removal rates in long-term experiments. 1. 8 +4000 m 450 As: 70 [46] Ind. bacteriaa Effect of bacterial adaptation 2. 6 and 2. 8 2380m 43 Cu: 92. 79 a Indigenous bacteria. 4. 3. Bioleaching of Electronic Waste Discarded cell phones, appliances, and printed circuit boards constitute the majority of e-wastes that may contain precious metals (Cu and Au), heavy metals (Pb, Sb and Hg), and other compounds (polybrominated diphenyl ethers and polychlorinated biphenyls) [ 52,53]. The constant growing demand for precious metals to satisfy industrial and population growth-related necessities has added to the strengthening and implementation of environmental policies, such as extended product responsibility, thereby highlighting the importance of treating e-waste. Bioleaching is gaining ground as an effective pathway for metal recovery from this source. Nevertheless, its application in this ﬁeld still requires further research, especially to determine optimum operational conditions and to ﬁnd a feasible process that may combine other technologies. The aim of this section is to address the work to date in the bioleaching of e-waste from electronic wastes found in Korean journals. Table 3 presents the relevant highlights of the research produced on the bioleaching of electronic waste. Table 3. Bioleaching research of electronic waste according to the parameters studied and recoveries achieved as well as microorganisms used in the studies. The articles appear in chronological order. Author(s) Microorganism(s) Parameters p H Particle Size Time (Day) Leaching (%) [54] T. ferrooxidans Solid concentration 2. 0 149m 7Cu and Co: 90; Al, Zn, and Ni: 40 [55] A. niger Chemical vs. biological leaching5. 5–6. 0500m 72Cu and Co: 95; Al, Zn and Pb: 15–35 [56] A. niger Bioleaching and solvent extraction combination2. 5500m - Cu: 99. 9 Several scholars reported their ﬁndings in metal recovery from electronic scrap by microbiological means. In ﬂask experiments, Ahn et al. [ 54] used T. ferrooxidans to leach heavy metals from e-waste and they focused on determining the optimum pulp density for the process. They achieved a 90% leaching efﬁciency of Cu and Co and a 40% efﬁciency of Al, Zn, and Ni at 10% of the solid concentration. However, the precipitation into lead (II) sulfate (Pb SO 4) and stannous oxide reduced Pb and tin (Sn) leaching, respectively. As a reference, the scholars compared these results with those obtained from the Minerals 2016 ,6, 128 8 of 21 bioleaching of metal powders containing the target metals; bioleaching of electronic scrap presented higher efﬁciencies. The use of fungi to recover minerals from electronic waste was also reported in the Korean Journal Database. The impact of reaction time and concentration of organic acids on the leaching efﬁciency by A. niger was emphasized by Ahn et al. [ 55]; the researchers obtained 95% leaching efﬁciency of Cu and Co at an electronic scrap concentration of 50 g/L. Using the same fungal species, Ahn et al. [ 56] conducted a combined process of bioleaching, solvent extraction (with LIX84), and electrowinning to recover Cu and Sn from a solution of electronic scrap. They reported a 99% recovery leaching rate that was directly proportional to the concentration of LIX84, considering 20% ( v/v) of LIX84 as the concentration limit. The results obtained using microorganisms to recover metals from e-waste are encouraging. Unfortunately, the currently scarce amount of literature from Korean journals makes it difﬁcult to determine the trends and future directions. Similar to the research approach used to treat other materials, the ﬁndings presented in Korean journals were related to the determination of basic operating conditions. Nonetheless, this area, due to its relevance from an environmental and economic perspective, has high potential and an intensive cooperation between academia and industry have to meet to exploit the opportunities. 4. 4. Bioleaching of Ores and Metal Concentrates Metal recovery from ores and concentrates constitute the main application of bioleaching worldwide. The proof of this fact is reﬂected in the 33 commissioned plants worldwide since 1986 (17 heap leaching and 16 stirred tank reactors) [ 57]. The main constraints that the bioleaching of mineral ores and concentrates face are mainly related to the long extraction times, the necessity to further process the generated by-products, and the metal toxicity to the biomining microorganisms. This section addresses the relevant ﬁndings to process these materials published in Korean journals. Table 4 summarizes the research conducted in this area. Table 4. Bioleaching research of mineral ores and metal concentrates research according to the parameters studied and recoveries achieved as well as microorganisms used in the studies. The articles appear in chronological order. Author(s) Microorganism(s) Parameters p H Particle Size Time (Day) Leaching (%) [58] T. ferrooxidans Particle size, pulp density, and Fe concentration2. 0 210–250 m 18 Cu: 78 [59] - Review - - - - [60] A. ferrooxidans Energy source, initial p H, pulp density, and temperature1. 0–2. 574m 30 Cu: 80 [61] A. ferrooxidans Thermal pretreatment 1. 5 - 33Ni: 59. 18 Co: 65. 09 [62] - Review - - - - [63] A. ferrooxidans Feasibility assessment 1. 5 1–9. 5 mm 100 Co: 10 [64] Ind. bacteriaa Chemical vs. biological leaching 4. 0 841m 10 - [65] Ind. bacteriaa Initial p H and temperature 4. 0, 7. 0, 9. 0 74m 19 - [66] Ind. bacteriaa Pulp density 4. 4 841m 84 - [67] - Review - - - - [68] Ind. bacteriaa Bacterial attachment 4. 20 74m 45 - [69]L. ferriphilum, Acidithiobacillus caldus Bacterial attachment 2. 0 149m - - [70] Ind. Bacteriaa Feasibility 3. 2 - 28 - [71] - Review - - - - [72] Ind. bacteriaa Temperature 2. 43 841m 16 - [73] A. ferrooxidans Feasibility assessment 1. 75 - 10 - [74] A. niger Strain variations 3. 5 - 23 Cu: 98 [75] A. niger Manganese supplement 6. 8 74m 27 Ni: 38. 6 [76] A
monteilii was also reported to be unable to use the following carbon sources: N-acetylglucosamine, esculin, m-aminobenzoate, p-aminobenzoate, 3-aminobutyrate, amygdalin, D-arabitol, L-arabitol, arbutin, L-cysteine, dulcitol, ethylamine, L-fucose,β-gentiobiose, glucosamine, glycogen, isophthalate, 5-ketogluconate, D-lyxose, L-lyxose, melezitose, melibiose, L-methionine, α-methylglucoside, α-methyl- D-mannoside, α-methyl-xyloside, raffinose, L-sorbose, terephthalate, raffinose, tagatose, D-tryptophan, D-turanose, xylitol, and L-xylose. c P. rhodesiae was also found to use acetylglucosamine and D-arabitol, and was unable to grow on esculin, 2-aminobenzoate, 3-aminobenzoate, 4-aminobenzoate, 3-aminobutyrate, amygdalin, L-arabitol, arbutin, L-cysteine, dulcitol, ethylamine, L-fucose, gentio- biose, glucosamine, glycogen, norvaline, raffinose, salicin, sorbose, D-tagatose, terephthalate, D-turanose, urea, xylitol, and L-xylose. d Positive for P. veronii ; results on other substrates not reported. e P. monteilii not tested. f No information on P. veronii. This article is © 2005 Bergey’s Manual Trust. Published by John Wiley & Sons, Inc. , in association with Bergey’s Manual Trust. Bergey’s Manual of Systematics of Archaea and Bacteria 47 TABLE 7. Characteristics differentiating Pseudomonas aeruginosa, P. balearica, P. stutzeri ,a n d P. putidaa Characteristics P. aeruginosa P. balearica P. putida P. stutzeri Type of colony : Smooth + + Wrinkled + + Number of flagella 1 1 >1 1 Hydrolysis of : Gelatin + − − − Starch − + − + Utilization of : Maltose − + d + Xylose − + d − γ-Aminobutyrate − − d d Malate d + − + Suberate d − − d Mannitol + − − d Ethylene glycol − − − + Denitrification + + − + Growth at : 42∘C + + − d 46∘C − + − d Growth in media with 8. 5% Na Cl − + − − Fatty acid content (%): C17:0 cyclo0. 8 4. 71 >5 0. 28–1. 72 C19:0 cyclo1. 2 3. 8 Traces 0. 32-1. 45 Mol% G +C of the DNA 67 64. 1–64. 4 60. 7–62. 5 60. 9–64. 9 a For symbols see standard definitions. Data from Bennasar et al. (1996) and Stanier et al. (1966). in Table 8. Details of its fatty acid composition are known (Stead, 1992). The organism causes drippy gill of mushrooms, and one of the main differences with another mushroom pathogen, P. tolaasii , is in the utilization of benzoate. Catechol is oxidized to a black pigment diffusing into the medium, a character also present in P. agarici. The species was tentatively assigned to RNA group I by Byng et al. (1980), and this position was fur-ther confirmed by r RNA–DNA hybridization (De Vos et al. ,1985) and by r DNA sequencing (Moore et al. , 1996). The mol %G+Co ft h e D N Ai s : 58. 8–61. 1 ( T m). Type strain : ATCC 25941, DSM 11810, LMG 2289. Gen Bank accession number (16S r RNA ): Z76652. Pseudomonas alcaligenes Monias 1928, 332AL. al. ca. li’ge. nes. M. L. adj. alcaligenes alkali-producing. Characteristics useful to differentiate the species from other Pseudomonas species are given in Tables 9 and 10. For further descriptive information see Ralston-Barrett et al. (1976) and Stanier et al. (1966). The nutritional spectrum isvery narrow, resembling that of highly mutated fluorescent organisms. The gelatinase reaction is negative. The type strain was isolated from swimming pool water (Hugh and Ikari, 1964). The mol %G+Co ft h e D N Ai s :6 4 – 6 8( B d ). This article is © 2005 Bergey’s Manual Trust. Published by John Wiley & Sons, Inc. , in association with Bergey’s Manual Trust. 48 Bergey’s Manual of Systematics of Archaea and Bacteria TABLE 8. Characters distinguishing some fluorescent Pseudomonas species associated with mushroom culturea Characteristics P. agarici P. cichorii P. fluorescens biovar II P. tolaasii Levan formation from sucrose − − + − Arginine dihydrolase − − + + Denitrification − − + − Gelatin hydrolysis − − + + Egg yolk reaction − + − + Growth at the expense of : Trehalose − − + d 2-Ketogluconate − − + d meso-Inositol − + + + L-Valine d − + + β-Alanine + − + + L-Arabinose − + + d Sucrose − + + − Sorbitol − − + + Adonitol − − d d Ethanol − − + d meso-Tartrate − + − + Nicotinate − − − + Staining of mushroom caps d + Pitting of mushroom caps − + a For symbols see standard definitions. Data from Fahy (1981) and Stanier et al. (1966). Type strain : Stanier 142, ATCC 14909, LMG 1224NCIB 9945, NCTC 10367. Gen Bank accession number (16S r RNA ): Z76653. Pseudomonas amygdali Psallidas and Panagopoulos 1975, 105AL. a. myg’da. li. L. n. amygdalum almond; L. gen. n. amygdali of the almond. The following description is taken from Psallidas and Panagopoulos (1975). Rods, 0. 7 ×1. 7μm or much longer (filaments can be 10–15 times the length of normal cells). Motile by means of one to six polar flagella. No PHB accumulated. Grows better in potato-dextrose medium than in nutrient agar. Growth range, 3–32∘C. No growth below p H 5. No fluorescent pig- ment produced. Acid is formed from D-ribose, L-arabinose, glucose, mannose, galactose, fructose, sucrose, mannitol, and sorbitol. No utilization of xylose, L-rhamnose, L-sorbose,cellobiose, lactose, maltose, melibiose, trehalose, raffinose, inulin, esculin, amygdalin, arbutin, salicin, dulcitol, ery- thritol, glycerol, inositol, dextrin and α-methyl- D-glucoside. Malate, citrate, succinate, and fumarate are utilized. Glu-conate is slowly assimilated. Acetate, propionate, oxalate, maleate, malonate, tartrate, lactate, sulfanilic acid, picrate, hippurate, and benzoate are not utilized. Among the nat- ural amino acids, serine, aspartate, glutamate, arginine, asparagine, proline, and histidine are utilized. Not usedas carbon and/or nitrogen sources are glycine, β-alanine, leucine, isoleucine, valine, lysine, ornithine, tyrosine, pheny- lalanine, tryptophan, cystine, cysteine, methionine, and creatine. Some isolates are urease positive. Tween 80 and trib- utyrin are rapidly hydrolyzed. Lechithinase and arginine dihydrolase negative. Gelatin, casein, esculin, arbutin, and starch are not hydrolyzed. Nitrates are not reduced. Rotting of potato slices does not occur, but the organism is positive in the hypersensitivity test on tobacco leaves. Further details. This article is © 2005 Bergey’s Manual Trust. Published by John Wiley & Sons, Inc. , in association with Bergey’s Manual Trust. Bergey’s Manual of Systematics of Archaea and Bacteria 49 TABLE 9. General characteristics of some nonfluorescent Pseudomonas speciesa Characteristics P. alcaligenes P. corrugata P. luteola P. mendocina P. oryzihabitans P. pseudoalcaligenes P. stutzeri Cell diameter, μm 0. 5 0. 8 0. 7–0. 8 0. 8 0. 7–0. 8 0. 7–0. 8 Cell length, μm 2. 0–3
Anaerobic degradation of indolic compounds by sulfate-reducing enrichment cul-tures, and description of Desulfobacterium indolicum gen. nov. , sp. nov. Arch. Microbiol. 146: 170–176. Bale, S. J. , K. Goodman, P. A. Rochelle, J. R. Marchesi, J. C. Fry, A. J. Weightman and R. J. Parkes. 1997. Desulfovibrio profun- dussp. nov. , a novel barophilic sulfate-reducing bacterium from deep sediment layers in the Japan Sea. Int. J. Syst. Bacteriol. 47: 515–521. Beijerinck, M. W. 1895. Über Spirillum desulfuricans als Ursache von Sulfatreduktion. Zentralbl. Bakteriol. Par-asitenkd. Infektionskr. Hyg. Abt. I Orig. 1:1 – 9 ;4 9 – 5 9 ; 104–114. Biebl, H. and N. Pfennig. 1977. Growth of sulfate-reducing bacteria with sulfur as electron acceptor. Arch. Microbiol. 112: 115–117. Brauman, A. , J. F. Köenig, J. Dutreix and J. L. Garcia. 1990. Characterization of two sulfate-reducing bacteria from the gut of the soil-feeding termite, Cubitermes speciosus. Antonie Leeuwenhoek 58: 271–275. Campbell, L. L. , M. A. Kasprzycki and J. R. Postgate. 1966. Desulfovibrio africanus sp. n. , a new dissimilatory sulfate-reducing bacterium. J. Bacteriol. 92: 1122–1127. Caumette, P. , Y. Cohen and R. Matheron. 1991a. Isolation and characterization of Desulfovibrio halophilus sp. nov. , isolated from Solar Lake (Sinai). Syst. Appl. Microbiol. 14: 33–38. Caumette, P. , Y. Cohen and R. Matheron. 1991b. In Valida- tion of the publication of new names and new combina-tions previously effectively published outside the IJSB. List No. 37. Int. J. Syst. Bacteriol. 41: 331. Chase, A. R. , J. W. Miller and J. B. Jones. 1984. Leaf spot and blight of Asplenium nidus caused by Pseudomonas gladioli. Plant Dis. 68: 344–347. Cooper, D. M. , D. L. Swanson, S. M. Barns and C. J. Gebhart. 1997. Comparison of the 16S ribosomal DNA sequencesfrom the interacellular agents of proliferative enteritisin a hamster, deer, and ostrich with the sequence of a porcine isolate of Lawsonia intracellularis. Int. J. Syst. Bacteriol. 47: 635–639. Cord-Ruwisch, R. , B. Ollivier and J. L. Garcia. 1986. Fructose degradation by Desulfovibrio sp. in pure cul- ture and in coculture with Methanospirillum hungatei. Curr. Microbiol. 13: 285–289. Devereux, R. , S. H. He, C. L. Doyle, S. Orkland, D. A. Stahl, J. Le Gall and W. B. Whitman. 1990. Diversity and origin of Desulfovibrio species: phylogenetic definition of a family. J. Bacteriol. 172: 3609–3619. Dilling, W. and H. Cypionka. 1990. Aerobic respiration in sulfate-reducing bacteria. FEMS Microbiol. Lett. 71: 123–127. Dreyfus, B. , J. L. Garcia and M. Gillis. 1988. Characteriza- tion of Azorhizobium caulinodans gen. nov. , sp. nov. , astem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata. Int. J. Syst. Bacteriol. 38: 89–98. Dunn, B. E. , H. Cohen and M. J. Blaser. 1997. Helicobacter pylori. Clin. Microbiol. Rev. 10: 720–741. Eaglesome, M. D. , M. I. Sampath and M. M. Garcia. 1995. A detection assay for Campylobacter fetus in bovine semen by restriction analysis of PCR amplified DNA. Vet. Res. Commun. 19: 253–263. Esnault, G. , P. Caumette and J. L. Garcia. 1988a. Char- acterization of Desulfovibrio giganteus sp. nov. , asulfate-reducing bacterium isolated from a brackishcoastal lagoon. Syst. Appl. Microbiol. 10: 147–151. Esnault, G. , P. Caumette and J. L. Garcia. 1988b. In Valida- tion of the publication of new names and new combina-tions previously effectively published outside the IJSB. List No. 26. Int. J. Syst. Bacteriol. 38: 328–329. Feio, M. J. , I. B. Beech, M. Carepo, J. M. Lopes, C. W. S. Cheung, R. Franco, J. Guezennec, J. R. Smith, J. I. Mitchell, J. J. G. Moura and A. R. Lino. 1998. Isolation and charac-terization of a novel sulphate-reducing bacterium of the Desulfovibrio genus. Anaerobe 4: 117–130. Feio, M. J. , I. B. Beech, M. Carepo, J. M. Lopes, C. W. S. Che- ung, R. Franco, J. Guezennec, J. R. Smith, J. I. Mitchell,J. J. G. Moura and A. R. Lino. 2000. In Validation of the publication of new names and new combinations previ- ously effectively published outside the IJSB. List No. 75. Int. J. Syst. Evol. Microbiol. 50: 1415–1417. This article is © 2005 Bergey’s Manual Trust. Published by John Wiley & Sons, Inc. , in association with Bergey’s Manual Trust. Bergey’s Manual of Systematics of Archaea and Bacteria 15 Foley, J. E. , J. V. Solnick, J. M. Lapointe, S. S. Jang and N. C. Pedersen. 1998. Identification of a novel enteric Heli- cobacter species in a kitten with severe diarrhea. J. Clin. Microbiol. 36: 908–912. Folkerts, M. , U. Ney, H. Kneifel, E. Stackebrandt, E. G. Witte, H. Förstel, S. M. Schoberth and H. Sahm. 1989a. Desul- fovibrio furfuralis sp. nov. , a furfural degrading strictly anaerobic bacterium. Syst. Appl. Microbiol. 11: 161–169. Folkerts, M. , U. Ney, H. Kneifel, E. Stackebrandt, E. G. Witte, H. Förstel, S. Schoberth and H. Sahm. 1989b. In Valida- tion of the publication of new names and new combina-tions previously effectively published outside the IJSB. List No. 31. Int. J. Syst. Bacteriol. 39: 495–497. Fröhlich, J. , H. Sass, H. D. Babenzien, T. Kuhnigk, A. Varma, S. Saxena, C. Nalepa, P. Pfeiffer and H. König. 1999a. Isolation of Desulfovibrio intestinalis sp. nov. from the hindgut of the lower termite Mastotermes darwiniensis. Can. J. Microbiol. 45: 145–152. Fröhlich, J. , H. Sass, H. D. Babenzien, T. Kuhnigk, A. Varma, S. Saxena, C. Nalepa, P. Pfeiffer and H. König. 1999b. In Validation of the publication of new names and newcombinations previously effectively published outside the IJSB. List No. 71. Int. J. Syst. Bacteriol. 49: 1325–1326. Gallus, C. , N. Gorny, W. Ludwig and B. Schink. 1997. Anaer- obic degradation of alpha-resorcylate by a nitrate-reducingbacterium, Thauera aromatica strain AR-1. Syst. Appl. Microbiol. 20: 540–544. Gebhart, C
Unfortunately, the ﬂight experiment did not result in usable data due to a technical failure. Another example is the PBR@LSR project. In this project, a PBR inoculated with Chlorella vulgaris was brought to the ISS in 2019. The proposed experiment time was 6 months, but the experiment had to be terminated after a few weeks due to technical issues(Keppler et al. , 2018). Table 4 shows a selection of space ﬂight experiments using photosynthetic unicellular organisms in illuminated test chambers (PBRs) that have been in space over the last 30 years. Since not all of the experiments in space have been successful, not all space experiments were published so that only experiments published in peer reviewed papers that could be used as references are shown. DISCUSSION In this section, we highlight the diﬀerent challenges in context of PBR for space applications in order to give an overview of Frontiers in Microbiology \| www. frontiersin. org 8 June 2021 \| Volume 12 \| Article 699525 fmicb-12-699525 June 29, 2021 Time: 15:9 # 9 Fahrion et al. Photobioreactors in Space FIGURE 1 \| (A) Nostoc sp. /Euglena gracilis container of the ﬁrst space ﬂight experiment associated with MELi SSA (Dubertret et al. , 1987), courtesy of ESA. (B)Limnospira indica hardware from the Art EMISS-B experiment (Poughon et al. , 2020, original source: QINETIQ). knowledge gaps and problems that already occurred or might arise in the future of BLSS research. Safety and Reliability – Robustness, Resilience, and Redundancy The safety and reliability of a life support system is of utmost importance. In order to avert fatal incidents, several back- up facilities and control mechanisms have to be installed and the system has to be monitored consistently. All possible scenarios have to be calculated and evaluated beforehand to avoid failure, because failure can be fatal for the crew (Bartsev et al. , 1996). For example, a failure in O 2production has to be intercepted by an emergency system before a drop in the O 2concentration of the cabin occurs. A high degree of redundancy has to be achieved. Physicochemical emergency back-up systems, plant compartments and diﬀerent PBRs could be put in parallel that can be uncoupled from each other. And not all bioreactors need to be operated in long duration continuous production, but a regime of alternating batches or operation and downtime of bioreactors could be implemented, if shown to be advantageous for operation, harvesting or maintenance. In addition, reliable mathematical models for the bioreactors are essential to keep all processes predictable (Vernerey et al. , 2001). This is a highly strategic point when the recycling eﬃciencies of diﬀerent elements and compounds are coupled and intertwined as it is the case for BLSS, such as MELi SSA. In this case, the action on an operational variable has distributed consequences at several points of the recycling system, calling for an intelligent control strategy based on knowledge models taking into account the dynamic exchanges between the diﬀerent parts of the recycling system. The other important point for life support systems for space is that the buﬀer tanks generally have a minimal capacity entailing an online control strategy. The criteria for reliability, availability, maintainability and supportability (RAMS) engineering have to be applied in the BLSS research. Gas Exchange and O 2/CO 2Balance Between Consumer and Producer As mentioned, on average, one human needs 0. 82 kg of O 2 and produces1. 04 kg of CO 2per day. Depending on the activity level, the ratio of exhaled CO 2to consumed O 2, i. e. , the respiratory coeﬃcient, can vary (Anderson et al. , 2018). On the other hand, the O 2production of algae and cyanobacteria can be characterized by a photosynthetic coeﬃcient, describing the ratio of produced moles of O 2per consumed moles of CO 2. This ratio is dependent on the organism (and its biochemical composition) and the nutrient substrate (e. g. , the nitrogen source). The stoichiometric eqs. 3, 4 [simpliﬁed from Cornet et al. (1998)] show this dependence for Limnospira indica on the examples ammonium (NH 3) and nitrate (NO 3or here: HNO 3) as nitrogen sources. Solving the stoichiometric equations reveals that the photosynthetic coeﬃcient for ammonium is 1. 0 and for nitrate1. 4. CO 2C0:528H2OC0:173NH 3Cnhn. CH 1:575O0:459N0:173 C1:034O2 (3) CO 2C0:701H2OC0:173HNO 3Cnhn. CH 1:575O0:459N0:173 C1:381O2 (4) Importantly, it must be outlined that photosynthetic growth stoichiometry has no degree of freedom when the composition of nitrogen source (or its degree of reduction) is ﬁxed so that the photosynthetic coeﬃcient is only depending and linked to the culture conditions. The number of photons required to ﬁx 1 mol of carbon is depending on the culture conditions. Away from photo inhibition conditions, a typical value is n= 20 mol photons per mol of carbon ﬁxed (Cornet and Dussap, 2009; Poulet et al. , 2020). In order to avoid an imbalance in gas composition, a system has to be developed to combine the respiratory quotient of the crew members and the photosynthetic coeﬃcient of the Frontiers in Microbiology \| www. frontiersin. org 9 June 2021 \| Volume 12 \| Article 699525 fmicb-12-699525 June 29, 2021 Time: 15:9 # 10 Fahrion et al. Photobioreactors in Space microalgae. In some experiments, successes were achieved (see section “Photosynthetic Microorganisms as Catalysers for Air Revitalization in Space”). However, gas exchange in space is much more complex, due to the lower or lack of gravity. There is still very little information about the gas, water and solute transport in microgravity in living organisms. Moreover, microgravity conditions strongly modify the environment of the chemical and biochemical processes, e. g. , implying lack of sedimentation and impaired gas and liquid phase separation. Consequently, transport is limited to diﬀusion causing an increase of boundary layer thickness and therefore a signiﬁcant decrease of mass and heat transfer coeﬃcients. This can cause problems with pumping and the mineral availability for the cultures and has to be elucidated more thoroughly (Klaus et al. , 1997). In situ Resource Utilization and Light as an Energy Source Another challenge is the complete closure of a BLSS. So far, no loop has an eﬃciency of 100%, which means that all tested life support systems still rely on external addition of diﬀerent substances like carbonate or trace elements, etc. For example, the 105 days long Lunar Palace 1 experiment (plants, insects, and three crew members) reached a full oxygen and water recycling but only 20. 5% nitrogen recovery from urine and 55% of the food was regenerated. In this approach, physico-chemical and biological processes were combined (Fu et al. , 2016). Some substances are either diﬃcult to ﬁnd in the space environment or it is very costly and time consuming to convert them into a usable form. Therefore, space habitats for humans have to be fully functional under the speciﬁc conditions and have to rely on the materials available around and only a small amount of material brought from Earth. For example, lunar regolith, mars soil and CO 2in the Martian atmosphere are promising substances to be used forin situ resource utilization (ISRU) (Montague et al. , 2012; Muscatello and Santiago-Maldonado, 2012). The usage of photoautotrophic organisms helps to overcome parts of the material problems because their main energy source is light. But so far, only experiments using artiﬁcial light (e. g. , halogen lamps or LEDs) have been ﬂown ( Table 4 ) which means that the naturally available solar energy is not used directly so far. One of the main reasons is that the natural light intensities and spectral energy distributions available in space are not compatible with the needs of the photosynthetic organisms. The intensity of sun light depends on the distance from the sun and the irradiation spectrum in deep space consists of a diﬀerent wavelength composition than the irradiation we experience on ground due to absorption of light in the Earth’s atmosphere (Cockell and Horneck, 2001). Besides that, the ISS, Moon and Mars surface are eclipsed for 50% of the time and the day and night cycles, e. g. , on the moon are very diﬀerent from Earth. For example, one lunar night is as long as 18 Earth days (Alvarado et al. , 2021; Xie et al. , submitted)1. Also, the intensity 1Xie, G. , Zhang, Y. , Y ang, J. , Yu, D. , Ren, M. , Qiu, D. , et al. (submitted). Adaptation to real 1/6 g Moon Gravity Contributes To Plant Development And Expeditious Acclimation To Super-Freezing. Chongqing, Research Square. doi: 10
A systematic approach in collecting the information is desirable to reduce the time or extraneous data requirements. In any flowsheet design and synthesis case, it is always recommended to start creating the flowsheet at a high level and gradually build the individual unit operations at the process level. This gives a preliminary screening of missing information and identifies the level of details required for each important process investigation. A block diagram is the most preferred method in showing the overall system configuration and material and energy flows. The block diagram for an integrated gasification system is shown in Figure 14. 6. The operating conditions (e. g. , temperature and pressure) of the gasification process, gas cleaning and conditioning and synthesis reaction are needed to solve the mass and energy balances of the integrated gasification flowsheet, as shownin the block diagram in Figure 14. 6. This information can normally be found in literature, technology provider websites,existing technology reports, etc. Mass balances include the flow and composition of feed, gas product, conditioned syngas and product streams. Energy balances include the heat released or consumed within the reactors and separators as well as the heat exchange processes involved between processes. The next step is detailed process modeling. This can be done using mathematical modeling if detailed reaction equations can be specified. Alternatively, the simulation modeling method can be adopted. Simulation packages such as Aspen Plus, Aspen HYSYS and PRO/II are among the widely used process simulation softwares in industry. They contain well-established unit operation models, thermodynamic property packages, chemical component databases and calculation algorithms that allow process modeling to be carried out efficiently and the generation of reliable results. Nevertheless, it should be remembered that validation of results ought to be performed no matter which modeling method (mathematicalor simulation) is adopted. Gasification Gas Cleaning and Conditioning Conditioned Syngas Synthesis Reaction Feed(Bio-oil) Product(Methanol) Gas Product Figure 14. 6 Block diagram showing the integrated gasiﬁcation system. 488 Bioreﬁneries and Chemical Processes The following general procedures can be adopted for simulation modeling of a process: Step 1. Set up a flowsheet environment comprising the following: r Pick the chemical components involved in the whole plant from the component database. r Choose a suitable thermodynamic property package. Step 2. Build the flowsheet starting from the main unit operation blocks: r Select a suitable unit operation model for the process to be modeled. Consider the simplest form of the model from a choice of readily available models. If the results are not satisfactory, then a more rigorous model is to be adopted, including a user-defined model. r Obtain the operating parameters of the processes to be modeled from the literature. r Perform simulation. r Validate the simulation results against the literature results. Step 3. Create the models for other auxiliary equipment and connect the streams between the processes: r The auxiliary facility includes devices for increasing or decreasing temperature and pressure, mixer or splitter as well as flash separators for vapor–liquid separation. Depending on the modeler’s preference, Steps 2 and 3 can also be carried out simultaneously by modeling the unit operation blocks in sequential order. This is sometimes more efficient because the intermediate streams between processes can be simulated and used for the later processes. Otherwise, an initial guess has to be made for the feed streams to the main unit operation. An example using ASPEN Plus simulation modeling is shown for the bio-oil integrated gasification system for the production of methanol. Refer to the Online Resourcematerialinthe Companion Website:Chapter14 for the operating conditions of the processes and their modeling, design and integration using Aspen Plus. 14. 5. 2 Sensitivity Analysis 14. 5. 2. 1 Sensitivity Analysison Gasification Process Gasification is the core process of the system. Its operating condition affects the operation, cost, product yields and purities of the downstream processes. For example, if a lower pressure is used in the gasifier, while the downstream process demands a higher pressure, then compression of syngas is needed, thus leading to a higher operating cost. On theother hand, a high pressure gasifer differs from the atmospheric or slightly higher pressure gasifier in terms of material of construction, lining and thickness of the reactor wall. If undesirable components are present in syngas due to an unoptimized operating condition, it would need more downstream cleaning or otherwise it might affect the product yieldfrom the synthesis reactions. Cautious choice of operating parameters of the gasifier is vital, since operating conditions decide the performance of the entire system. The operating parameters that can be manipulated in the gasifier to produce favorable syngas quality are as follows: r Pressurer Temperaturer Oxygen flow rate or oxygen-to-feed ratior Steam flow rate or steam-to-feed ratio Steam is normally added as the gasifying medium. Generally, moist biomass has enough moisture to atomize biomass to ease the primary pyrolysis or devolatilization reactions in the gasifier. Since bio-oil is in liquid form and has a significant amount of water, steam is not needed in this case. Bio-Oil Reﬁning I 489 Sensitivity analysis should be performed for the variation of the above-mentioned operating parameters. There should be a systematic way to move towards optimal operating conditions. This would give an idea on the range of the correct conditions to generate syngas with the desired quality. There are three main criteria to inspect when carrying out sensitivity analysis for the gasifier: r The H2/CO molar ratior By-product formation such as CH4r No NOxor SOxformation by retaining an oxygen lean environment. Oxygen input should just be adequate to convert all carbon present in the biomass into carbon monoxide. Only consider the net oxygen requirement by subtracting theoxygen content in the biomass and associated moisture. (a)Pressureof Gasifier Pressure has a negligible impact on the syngas composition. This is primarily due to equimolar stoichiometric gasificationreactions and the pressure has less effect in changing the equilibrium composition, according to Le Chatelier’s principle. Although the effect of pressure on the syngas composition is negligible, the downstream operation ought to be taken into account while considering the operating pressure of the gasifier. For example, methanol synthesis operates at high pressure (e. g. 100 bar). Therefore, the pressure of the gasifier is elevated to reduce the compression power. There alsoexists a trade-off between the cost of operating the gasifier at high pressure and the cost of compression of syngas before the synthesis reaction. For CHP generation, the recommended biomass gasifier pressure is 30–50 bar. (b)Temperatureof Gasifier A higher temperature in the gasifier is preferred due to the following reasons: r Higher mole fraction of CO and H2r Lower mole fraction CO2and CH4 This is shown in Figure 14. 7(a). H2and CO are the main constituents of the methanol synthesis reaction; hence higher amounts of these components are desirable. However, the amount of H2decreases beyond 1000◦C. The decline of the H2component also suggests that the heating value of the syngas is lowered. Lower power is obtained if syngas is utilized for power generation. This can still be improved by placing a water gas shift reaction to increase the proportion of H2. On the other hand, the H2/CO molar ratio of the syngas should be monitored so that the syngas can be fed to the downstream process without undergoing rigorous conditioning (i. e. , water gas shift). The H2/CO molar ratio is lowered sharply between temperatures of 500◦C and 700◦C, and the effect is less significant beyond 700◦C. This is shown in Figure 14. 7(b). CO2and CH4are undesirable products from gasification. CO2has a dilution effect on the heating value of syngas and cost is incurred for removing CO2. The CO2content in the syngas at the temperature beyond 1000◦C is acceptable. A relatively higher proportion of CH4is helpful if the syngas is used to generate power, but is undesirable for synthesis reactions such as methanol and FT liquids. For CHP generation, a gasifier temperature of 950◦C is recommended. (c)Variationofoxygen-to-feedratio The oxygen input to gasification reaction needs to be properly controlled. This is because excess oxygen input causes more CO2rather than CO formation, that is, the combustion reaction dominates the partial oxidation reaction. This is evident from Figure 14. 8(a), which shows that increasing the O2/feed molar ratio leads to undesirable effects such as an increase in CO2and a decrease in CO and H2formation. Also, a higher H2/CO molar ratio in syngas can be attained at a lower O2/feed molar ratio, shown in Figure 14. 8(b). Hence, less theoretical oxygen is to be maintained in the gasifier. The following are the heuristics for gasification process operations: r Pressure – select a pressure by considering the operating conditions of the downstream processes. r Temperature – use a temperature close to 1000◦C. r Oxygen-to-feed molar ratio – use a lower oxygen-to-feed molar ratio, that is, around 0. 5. 490 Bioreﬁneries and Chemical Processes (a) 0. 45 0. 40 0. 350. 350. 250. 200. 150. 100. 05 0. 00 0 500 1000 1500 2000H CO2 H2O CH4COComponents’ Mole Fraction Temperature (°C) 0. 000. 501. 001. 502. 002. 503. 003. 504. 004. 50 1600 1400 1200 1000 800 600 (b)400H2/CO Molar Ratio Temperature (°C) Figure 14
1371/journal. pcbi. 1000312. Tshilombo, A. F. , 2006. Mechanism and kinetics of chalcopyrite passivation and depassivation during ferric and microbial leaching. Ph D thesis. University of British Columbia, Canada. Tuovinen, O. H. , Bhatti, T. M. , 1999. Microbiological leaching of uranium ores. Miner. Metall. Process. 16 (4), 51 –60. Van Niekerk, J. , 2019. Personal communication. Unlocking value from refractory gold projects using the Outotec BIOX process. Oral presentation at Journée Scientifique en bio hydrométallurgie. Vald’Or, Québec, Canada, 26 September 2019. Vardanyan, N. , Sevoyan, G. , Navasardyan, T. , Vardanyan, A. , 2018. Recovery of valuable metals from polymetallic mine tailings by natural microbial consortium. Environ. Technol. 40(26), 3467-3472. Vera, M. , Schippers, A. , Sand, W. 2013. , Progress in bioleaching: fundamentals and mechanisms of bacterial metal sulfide oxidation – part A. Appl. Microbiol. Biotechnol. 97(17), 7529 -7541. Vickers, C. , Small, I. , 2018. The synthetic biology revolution is now – here’s what that means. The Conversation. September 5, 2018. [URL] -synthetic -biology -revolution -is-now-heres -what -that-means -102399. Vuorenmaa, E. A. , Mä kinen, J. , Korhonen, T. , Neitola, R. , Kaksonen, A. H. , 2017. Pilot -scale bioleaching of metals from pyritic ashes. Solid State Phenom , 262, 147-150. Wang, H. , Liu, X. , Liu, S. , Yu, Y. , Lin, Jianqun, Lin, Jianqiang, Pang, X. , Zhao, J. , 2012. Development of a markerless gene replacement system for Acidithiobacillus ferrooxidans and construction of a pfk B Mutant. Appl. Environ. Microbiol. 78(6), 1826 -1835. doi:10. 1128/AEM. 07230 -11. Wang, J. T. , Hong, Y. W. , Lin, Z. C. , Zhu, C. L. , Da, J. , Chen, G. H. , Jiang, F. , 2019. A novel biological sulfur reduction process for mercury -contaminated wastewater treatment. Water Res. 160, 288 -295. Watling, H. R. , 2006. The bioleaching of sulphide minerals with emphasis on copper sulphides – A review. Hydrometallurgy 84, 81 -108. Wei, X. , Liu, D. , Huang, W. , Huang, W. and Lei, Z. , 2020. Simultaneously enhanced Cu bioleaching from E -wastes and recover ed Cu ions by direct current electric field in a bioelectrical reactor. Bioresource Technol. 298, 122566. Wu, X. , Zhao, F. , Rahunen, N. , Varcoe, J. R. , Avignone -Rossa, C. , Thumser, A. E. , Slade, R. C. T. , 2011 A role for microbial palladium nanoparticles in e xtracellular electron transfer. Angew. Chem. Int. Ed. 50, 427 -430. Xia, J. L. , Song, J. -J. , Liu, H. -C. , Nie, Z. -Y. , Shen, L. , Yuan, P. , Ma, C -Y. , Zheng, L. , Zhao, Y. -D. , 2018. Study on catalytic mechanism of silver ions in bioleaching of chalcopyrite by SR -XRD and XANES. Hydrometallurgy 180, 26 -35. Yan, S. , Cheng, K. Y. , Morris, C. , Douglas, G. , Ginige, M. P. , Zheng, G. , Zhou, L. , Kaksonen, A. H. , 2020. Sequential hydrotalcite precipitation and biological sulfate reduction for acid mine Journal Pre-proof Journal Pre-proof 40 drainage treatment. Chemosphere. 252, 126570. Yelloji Rao, M. K. , Natarajan, K. A. , 1989. Electrochemical effects of mineral -mineral interactions on the flotation of chalcopyrite and sphalerite. Int. J. Miner. Process. 27(3), 279 -293. Yu, Y. , Liu, X. , Wang, H. , Li, X. , Lin, J. , 2014. Construction and characterization of tet H overexpression and knockout strains of Acidithiobacillus ferrooxidans. J. Bacteriol. 196(12), 2255-2264. doi:10. 1128/JB. 01472 -13. Yu, Z. , Han, H. , Feng, P. , Zhao, S. , Zhou, T. , Kakade, A. , Kulshrestha, S. , Majeed, S. , Li, X. , 2020. Recent advances in the recovery of metals from waste through biological processes. Bi o- resour. Technol. 297, 122416. doi:10. 1016/j. biortech. 2019. 122416. Yuehua, H. , Guanzhou, Q. , Jun, W. and Dianzuo, W. , 2002. The effect of silver -bearing catalysts on bioleaching of chalcopyrite. Hydrometallurgy 64(2), 81 -88. Yunker, S. B. , Radovich, J. M. , 1986. Enhancement of growth and ferrous iron oxidation rates of T. Ferrooxidans by electrochemical reduction of ferric iron. Biotechnol, Bioeng, 28(12), 1867-1875. Zea, L. , Mc Lean, R. J. C. , Rook, T. A. , Angle, G. , Carter, D. L. , Delegard, A. , Denvir, A. , Ge r- lach, R. , Gorti, S. , Mc Ilwaine, D. , Nur, M. , Peyton, B. , Stewart, P. , Sturman, P. , Velez Justin i- ano, Y. A. , Potential biofilm control strategies for extended spaceflight missions (in review) Zhang, R. , Hedrich, S. , Ostertag -Henning, C. , Schippers, A. , 2018 a Effect of elevated pressure on ferric iron reduction coupled to sulfur oxidation by biomining microorganisms. Hydrometa l- lurgy 178, 215 -223. Zhang, Y. P. , Zhang, L. , Li, L. H. , Chen, G. H. , Jiang, F. , 2018b. A novel elemental sulfur reduction and sulfide oxidation integrated process for wastewater treatment and sulfur recycling. Chemical Eng. J. 342, 438 -445. Zhang, L. , Zhang, Z. F. , Sun, R. R. , Liang, S. , Chen, G. H. , Jiang, F. , 2018c. Self -accelerating su l- fur re -duction via polysulfide to realize a high -rate sulfidogenic reactor for wastewater treatment. Water Res. 130, 161 -167. Zhao, H. B. , Wang, J. , Tao, L. , Cao, P. , Yang, C. , Qing, W. , Qiu, G. , 2017. Roles of oxidants and reductants in bio leaching system of chalcopyrite at normal atmospheric pressure and 45 degrees C. Int. J. Miner. Process. 162, 81 -91. Journal Pre-proof Journal Pre-proof 41 Highlights  Deep subsurface and space biomining are gaining increasing interest  Biomining is being expanded to alternative lixiviants and commodities  Low-grade feed utilisation often requires integrated processes and impurity r e- moval  Waste mining and industrial ecology can help to maximise the use of resources  The capabilities of biomining microbes are being expanded through synthetic biology Journal Pre-proof Journal Pre-proof
Within Lan TERN’s dynamicrange,wecalculated EC50 valuesfor Lan TERNtobe976n Mforlanthanumand4. 71 μMforytterbium,withnomeasurableresponsetocalcium (Supplemental Table1),copper(II), cobalt(II),iron(II), magnesium, ormanganese(Supplemental Figure9). Thisis Figure1. Rational engineering of EFhandmotifsconverts GCa MP intoalanthanide sensor. (A)Sequencesof EFhands1,2,3,and4of GCa MP,Lan M-GCa MP, and Lan TERN. Aminoacidsidenticalto GCa MParegreen;aminoacidsderivedfrom Mex-Lan Mandnotfoundin GCa MPareblue;interveninglinkers(nottoscale)aredepictedaslines. Redstarsindicateaminoacidsidechainsshownasredsticksin(B). (B) Overlaidmodelsofmetal-bound Lan M-GCa MP (blue)and Lan TERN(green). Prolinesat EFhandposition2andputativelanthanide-binding aspartatesat EFhandposition9areshownasredsticks. (C)Fluorescence measurements of500n MLan M-GCa MP (see Figure1A,middleand Figure1B,blue)inthepresenceofvaryingcalcium,lanthanum,andytterbiumconcentrations. Pointsanderrorbarsrepresentthemeanand standarddeviationofthreetechnicalreplicatesfromthesameproteinpurification andworkingdilution. Graphsoftwoadditionalprotein purifications canbefoundin Supplemental Figure3. (D)Fluorescence measurements of500n MLan TERN(see Figure1A,bottom,and Figure 1B,green)invaryinglanthanum,ytterbium,andcalciumconcentrations. Pointsanderrorbarsrepresentthemeanandstandarddeviationofthree technicalreplicatesfromthesameproteinpurificationandworkingdilution. Graphsoftwoadditionalproteinpurifications canbefoundin Supplemental Figure4. ACSSynthetic Biology pubs. acs. org/synthbio Technical Note [URL] ACSSynth. Biol. 2024,13,958−962959 animprovement ofgreaterthan2ordersofmagnitudeover Lan M-GCa MP. Lan TERN’s lanthanide-dependent increasein fluorescence versusbaselinealsoincreasedover Lan M- GCa MP’s(e. g. ,>10-foldchangevs∼3. 5-foldchangein responsetolanthanum) (Figure1d). Wealsomeasuredthe apparent Kdof Lan TERNfor La3+usingchelator-buffered titrations12andcalculatedittobe40−60p M,whichisinline withotherworkonproteinscontaining Lan MEFhands (Supplemental Figure11). 3,7 Importantly, our Lan TERNdesignalsoswitchesthe functionof GCa MP. Wefoundthat Lan TERNdoesnot respondtocalcium,asitsresponsetolanthanideswasnearly identicalinthepresenceofcalciumconcentrations ashighas 500μM(Supplemental Figure10). Toconfirmtheimportance oftheprolineresidueinthesecondpositionofeach engineered EFhand,wecreateda Lan TERNvariantwhere thesecondpositionprolinewasback-mutated tothecognate aminoacidfoundinwild-typecalmodulin. Asexpected,these mutationsreducedthesensor’sresponsetolanthanides by approximately 10-foldandrestoreditsresponsetocalcium (Supplemental Figure2). Finally,wecharacterized Lan TERN’s responseto10 lanthanides thatspantheatomicweightofthisclass. Lan TERNrespondstoalllanthanidestested:weobserveda 14-foldorgreaterlanthanide-dependent fluorescence increase versusbaseline(Figure2). Thesensorexhibitedbinding preferences similarto Mex-Lan M, generallyresponding at lowerconcentrations ofthelighterlanthanides(Figure2B). 3,4 Thedifferencein EC50valuesforthelightestandheaviest lanthanidestesteddifferedbyapproximately 4-fold. However, Lan TERN’s EC50valuesareontheorderoftheconcentration ofthesensor,meaningthat Lan TERN’s actualaffinityforthe lanthanidesislikelymuchhigher. ■DISCUSSION Inthisstudy,wereporttheconstruction of Lan TERN,a lanthanide-responsive fluorescent protein. Werationallyengineered EFhandmotifstobuildafluorescentprotein sensorwithswitchedspecificityforlanthanidesversuscalcium. Thiscapabilityopensnewavenuesforthecreationof improvedlanthanide-binding proteins. Lan TERNcouldbe usedasasensingtoolindirectedevolutionstudiestoidentify mutationsin EFhandsthatincreasetheselectivityandaffinity forspecificlanthanides. Forexample,improvedvariantsof Lan TERNcouldbefoundusingyeastsurfacedisplayand fluorescence-activated cellsorting,whichisnotpossibleusing luminescence sensorsbasedonterbium. Theseimproved binderscouldbeusedinsyntheticbiologicalapproachesfor separatinglanthanides. Alternatively, Lan TERNcouldalsobeusedtodevelop engineered calmodulin domainsforbiosensing systems. Lan TERN’s M13andengineeredcalmodulindomainscould besplitandusedaslanthanide-dependent heterodimeric binders. Eachofthesedomainscouldthenbeattachedto components ofadimerization-based cellcontrolsystem. Such systemscouldthenutilizethelanthanide-dependent dimeriza- tionof M13and Lan TERNcalmodulintocreatealanthanide- dependentresponseforcellularfunctionssuchastran- scription13,14orphosphorylation15ortocreateluminescence- basedsensors. 16Thesesystems,especiallywhencombined withcalmodulins fromimprovedandmorespecific Lan TERN variants,wouldenablethecreationoforganismsthatrespond tothepresenceoflanthanidesandassistintheextractionand separationoflanthanides. ■METHODS Detailedprotocolsforallmethodsusedinthisreportaregiven inthe Supporting Information. Annotatedsequencesforall constructsusedarelistedinthe SIzipfile. AT7bacterial expressionconstructfor Lan TERNisavailableon Addgene (Addgene ID214061). ■ASSOCIATED CONTENT +sıSupporting Information The Supporting Information isavailablefreeofchargeat [URL] Supplemental methodsandprotocolsforexperiments andanalysisperformedinthisreport;La,Yb,and Ca dose−response of Lan M-GCa MP variantswithdifferent Lan Mhandordering(Supplemental Figure1);La,Yb, and Cadose−response of Lan TERN withback mutationsinthesecondpositionofeach EFhand (Supplemental Figure2);La,Yb,and Cadose−response of Lan M-GCa MP, includingallthreeindependent proteinpurifications (Supplemental Figure3);La,Yb, and Cadose−response of Lan TERN,includingallthree independent proteinpurifications (Supplemental Figure 4);La,Yb,and Cadose−response of Lan M-GCa MP variantswithdifferent Lan Mhandorderings,including allthreeindependent proteinpurifications (Supplemen- tal Figure5);La,Yb,and Cadose−response of Lan TERNshowingnonmonotonic dynamicsoutsideof Lnmax(Supplemental Figure6);La,Yb,and Cadose− responseof Lan TERNwithbackmutationsinthe secondpositionofeach EFhand,includingallthree independent proteinpurifications (Supplemental Figure 7);dose−response of Lan M-GCa MP to10lanthanides, includingallthreeindependent proteinpurifications (Supplemental Figure8);Lan TERN responseto Figure 2. Lan TERN responds toalltestedlanthanides. (A) Fluorescence measurements of500n MLan TERNinthepresenceof varyingconcentrations oflanthanideslistedinorderofatomicmass. Pointsanderrorbarsrepresentthemeanandstandarddeviationof threetechnicalreplicatesfromthesameproteinpurification and workingdilution. Linesrepresentalinearinterpolation between points. Graphsoftwoadditionalproteinpurifications canbefoundin Supplemental Figure8. (B)Tableofcalculated EC50valuesof Lan TERNinresponsetolanthanides. Lanthanides areshowninorder ofatomicnumber(Z). Valuesrepresentthemean ±standard deviationsofthreeindependent proteinpurifications of Lan TERN. Valuesfortheindividualproteinpurifications canbefoundin Supplemental Table1. ACSSynthetic Biology pubs. acs. org/synthbio Technical Note [URL] ACSSynth. Biol
The concentration of polysaccharide in EPS of at- there are only a few free metal ions, such as Fe3+, Fe2+, and tached cells in various growth phases decreases with the in- Cu2+ on the ore surface due to EPS bound action. It was re- crease in p H value as the following order: p H 1. 0 > 1. 5 > 2. 0 ported that Fe2 can shift from EPS phase into solution phase, > 2. 5, which is positively related to the solution acidity. but it is difficult for Fe3+ to shift from EPS phase into solu- However, there is an obvious difference, the amount of tion phase due to its hydroxylation and EPS complex action. polysaccharide in EPS of free cells in the leaching solution At the same time, small molecule H ions can move freely is closely related to the total concentration of solution in the in the EPS biofilm layer. The result is in agreement with Ref. logarithmic phase, whereas, the concentration of polysac- [19]. Zeng et al. [17] reported that the EPS concentration charide in EPS of the attached cells on ore is only related to gradually increased with the bioleaching time and reached a the p H value of the bioleaching solution in the logarithmic stable value toward the end. This was because the solution phase. It indicates that the attached cells on the ore surface p H value decreased gradually with the bioleaching time and are moderately affected by the concentration of soluble reached a stable value toward the end in this study. 18 35 (a) (b) 16 Logarithmic phaseof cells growth Adaptive phase of cells growth 25 10 20 15 10 1. 0 1. 5 2. 5 1. 0 1. 5 2. 0 2. 5 p Hvalues p Hvalues (d) 12 Deathphaseofcellsgrowth Stationary phaseof cells growth 1. 0 1. 5 2. 0 2. 5 1. 0 1. 5 2. 0 2. 5 p Hvalues p H values Fig. 3. Variation of extracellular polysaccharide content extracted from attached microorganisms with p H values: (a) adaptive phase; (b) logarithmic phase; (c) stationary phase; (d) death phase. 4. Conclusions increase in p H values, but is not related to the total concen- tration of soluble metal ions in the solution due to the EPS (1) The influence of p H values on extracellular polysac- bound action in the biofilm on the chalcopyrite surface. charides secreted by free cells in the bioleaching solution is closely related to three factors: the solution p H value, the Acknowledgements total concentration of soluble metal ions, and the ability of growth and metabolism. The optimal bacterial growth con- This work was financially supported by the National Ba- ditions are less suitable for EPS production. sic Research Priorities Programof China(No. (2) The polysaccharide concentration in EPS by attached 2010CB630903) and the National Nature Science Founda- cells is higher than that by free cells, and decreases with the tion of China (No. 31200382). 316 Int. J. Miner. Metall. Mater. , Vol. 21, No. 4, Apr. 2014 References Soc. China, 21(2011), No. 7, p. 1634. [11] C. Pogliani and E. Donati, The role of exopolymers in the bioleaching of a non-ferrous metal sulphide, J. Ind. Microbiol. [1] H. R. Watling, The bioleaching of sulphide minerals with Biotechnol. , 22(1999), p. 88. emphasis on copper sulphides: a review, Hydrometallurgy, 84(2006), No. 1-2, p. 81. [12] T. Gehrke, R. Hallmann, and W. Sand, Importance of [2] N. Pradhan, K. C. Nathsaram, K. Srinivasa Rao, L. B. Sukla, exopolymers from Thiobacillus ferrooxidans and Lepto- and B. K. Mishra, Heap bioleaching of chalcopyrite: a review, spirillum ferrooxidans for bioleaching. [in] Biohydrometal- Miner. Eng. , 21(2008), No. 5, p. 355. lurgical Processing, C. A. Jerez, T. Vargas, H. Toledo, and J. V. Wiertz, eds. , University of Chile, Santiago, 1(1995), p. 2. [3] C. Klauber, A critical review of the surface chemistry of acidic ferric sulphate dissolution of chalcopyrite with regards [13] T. Gehrke, J. Telegdi, D. Thierry, and W. Sand, Importance to hindered dissolution, Int. J. Miner. Process. , 86(2008), No. of extracellular polymeric substances from Thiobacillus fer- 1-4, p. 1. rooxidans for bioleaching, Appl. Environ. Microbiol. , [4] J. Vilcaez, R. Yamada, and C. Inoue, Effect of p H reduction 64(1998), No. 7, p. 2743. [14] K. Kinzler, T. Gehrke, J. Telegdi, and W. Sand, Bioleaching: and ferric ion addition on the leaching of chalcopyrite at thermophilic temperatures, Hydrometallurgy, 96(2009), No. a result of interfacial processes caused by extracellular poly- 1-2, p. 62. meric substances (EPS), Hydrometallurgy, 71(2003), No. 1-2, N. Hiroyoshi, H. Kitagawa, and M. Tsunekawa, Effect of so- p. 83. [5] [15] R. L. Yu, J. Liu, A. Chen, D. L. Zhong, Q. Li, W. Q. Qin, G. Z. lution composition on the optimum redox potential for chal- Qiu, and G. H. Gu, Interaction mechanism of Cu2+, Fe3+ ions copyrite leaching in sulfuric acid solutions, Hydrometallurgy, 91(2008), No. 1-4, p. 144. and extracellular polymeric substances during bioleaching chalcopyrite by Acidithiobacillus ferrooxidans ATCC2370, [6] IY. G. Wang, L. J. Su, L. J. Zhang, W. M. Zeng, J. Z. Wu, L. L. Trans. Nonferrous Met. Soc. China, 23(2013), p. 231. Wan, G. Z. Qiu, X. H. Chen, and H. B. Zhou, Bioleaching of chalcopyrite by defined mixed moderately thermophilic con- [16] R. L. Yu, Y. Ou, J. X. Tan, F. D. Wu, J. Sun, L. Miao, and D. L. Zhong, Effect of EPS on adhesion of Acidithiobacillus fer- sortium including a marine acidophilic halotolerant bacterium, Bioresour. Technol. , 121(2012), p. 348. rooxidans on chalcopyrite and pyrite mineral surfaces, Trans. [7] J. A. Brierley, Acidophilic thermophilic archaebacteria: po- Nonferrous Met. Soc. China, 21(2011), No. 2, p. 407. [17] W. M. Zeng, G. Z. Qiu, H. B. Zhou, X. D. Liu, M. Chen, W. L. tential application for metals recovery, FEMS Microbiol. Lett. , Chao, C. G. Zhang, and J. H. Peng, Characterization of ex- 75(1990), No. 2-3, p. 287. [8]E. Gomez, A. Ballester, M. L. Blazquez, and F. Gonzalez, tracellular polymeric substances extracted during the bioleaching of chalcopyrite concentrate, Hydrometallurgy, Silver-catalysed bioleaching of a chalcopyrite concentrate with mixed cultures of moderately thermophilic microorgan- 100(2010), No. 3-4, p. 177. isms, Hydrometallurgy, 51(1999), No. 1, p. 37. [18] Y. D. Karkhanis, J. Y. Zeltner, J. J. Jackson, and D. J. Carlo, A new and improved microassay to determine 2-keto-3-de- [9] W. Sand and T. Gehrke, Extracellular polymeric substances mediate bioleaching/biocorrosion via interfacial processes oxyoctonate in lipopolysaccharide of gram-negative bacteria, involving iron (Il) ions and acidophilic bacteria, Res. Micro- Anal. Biochem. , 85(1978), No. 2, p. 595. [19] R. L. Yu, J. X. Tan, G. L. Gu, Y. H. Hu, and G. Z. Qiu, Mecha- biol. , 157(2006), No. 1, p. 49. [10] R. L. Yu, D. L. Zhong, L. Miao, F
C Results after 1 week at 80 °C. High conversion is mediate. B, C Percentage of different species formed during the Click Zip process achieved even for the slower-reacting Ln" ions (≥85% from Sm" to Lu" and Y"), as a function of the metal and time. Conditions: 0. 5 m M Ph L' and 1. 0 m M Ln" salt with low amounts of side-products (red bar). The efficacy of Click Zip is low for (including " and Sc I) in 50 m M aq. MOPS/Na OH buffer (p H 7. 0) at 80 °C (except metal ions that are too large (La to Nd") or too small (Sc"), yet the corresponding for column L, where no metal was added). Analysis: HPLC with UV detection at Ph{Ln} can still be isolated (except for very labile Ph(Sc). The reaction without = 280 nm (further details in Supplementary Fig. 3). Starting purity of Ph L prior to any Ln" (column L) provides a mixture of products. Identified side-products the experiment is labelled as CONTROL (details about Ph L' stability in Supple- include Ph L-MOPS adduct (see Supplementary Fig. 4), Ca" chelate Ph Ca, and mentary Fig. 4). Identified species are colour-coded as shown in the legend, with all empty cages (1,4-cz-Ph L and 1,5-cz-Ph L'). Source data available in Supplemen- other detected species jointly shown in red. B Results after1h at 80 °C. The efficacy tary Data 2. Nature Communications \|(2024)15:9836 2 Article [URL] best described as a metal-templated Huisgen cycloaddition. Practically yields under specific optimized conditions, confirmed by X-ray analy speaking, the Click Zip process runs as one-pot reaction in fully aqu- sis (Supplementary Fig. 10). These results indicate that complexation eous solution under heating (80 °C). of a size-matched metal ion (here Na') or a specific degree of proto- nation (intramolecular hydrogen bonds) have similar templating Note on abbreviated notation effects towards 1,5-triazole formation, while the absence of metal For brevity, the following notation will be used throughout the text for templating may provide the other isomer. specific chemical species (see Supplementary Fig. 2): I (open che- Direct complexation of Ln" ions with 1,5-cz-Ph L' was unsuccess- lator); RL (L derivatized with R); [M(RL')] (open chelate of metal M ful, with no Ph{Ln} product detectable after heating to 80 °℃ for 1 week with RL'); 1,4-cz-RL' and 1,5-cz-RL' (empty cages with 1,4- and 1,5- or 6 months (Supplementary Figs. 11 and 12). Instead, formation of triazole bridge, respectively); 1,4-cz-[M(RL')] and 1,5-cz-[M(RL')] Ph{Ca} was observed, detected previously in trace amounts in reac- (Click Zip chelates with 1,4- and 1,5-triazole bridge, respectively). Unless tions with Ln" ions (Fig. 1) and synthesis of empty cages (Supple- important for isomer distinction, the most discused 1,5-cz-[M(RL)] is mentary Fig. 9), likely due to Ca" ions leaching from the glassware. This further abbreviated to R(M}. is in stark contrast to the 1,4-cz-Ph L' isomer, which provided 1,4-cz- [Ln(Ph L')] chelates by direct complexation of Ln" ions under the same Metal ion role and preferences conditions, though with mediocre yields. Lanthanide chelates of both Several observations point towards a templating rather than catalytic types thus could be accessed via different strategies (Supplemen- role of the Ln" ion in the Click Zip reaction. Firstly, the Click Zip rates tary Fig. 13). and yields strongly depend on ionic radius, increasing from La'to Lu (Fig. 1B-C, numerical values for all plots are available in Supplementary Kinetic inertness Data 2), with '" flling between Dy and Ho", confirming this trend. The kinetic inertness of the chelates was tested by acid-assisted Secondly, using excess metal expediates the complexation, but the dechelation under pseudo-first-order conditions with excess HCl, unchelated metal does not promote intermolecular triazole cross- quantitatively monitored by LC-MS and expressed as half-lives. linking. Thirdly, the purity, yield, and reaction rate of Click Zip are Chelates of a DOTA derivative [Ln(NO2Bn DOTA)], amenable to LC- remarkably independent of concentration (5 μM-50 m M), with devia- MS detection, served as a reference34. Four increasingly demanding tions notable only at the extreme limits (Supplementary Fig. 5). conditions from 0. 1 M HCI at 25 °C to 6. 0 M HCl at 80 °C were used to Overall, these results indicate that the chelated metal ion exerts cover a broad range of half-lives. This revealed an increase in inert- indirect steric effects through coordination of the pyridines rather ness across the series of Ph{Ln} chelates, spanning 10 orders of than participating directly in the azide-alkyne cycloaddition. It is worth magnitude from La to Lu (Fig. 2A). Starting from Sm, Ph{Ln} sur- noting that, for lanthanides from the end of the series, the efficacy and passed inertness of the DOTA system, steadily improving up to Lu purity of the Click Zip reaction is easily amenable to upscaling (Sup- (Supplementary Figs. 14-18). Ph{Lu} showed very high resistance to plementary Fig. 6). dechelation even under the harshest conditions (Fig. 2B). With an estimated half-life of 3 years in 6. 0 M HCl at 80 °C, this system 1,4-/1,5-Triazole selectivity exhibits greater inertness than other lanthanide chelates previously The surprising regioselectivity of Click Zip towards 1,5-triazole pro- reported as highly inert27-29. In contrast, the isomeric 1,4-cz ducts regardless of the Ln" choice and ligand derivatizations (Sup- [Ln(Ph L')] chelates were much less kinetically inert, approximately 2 plementary Fig. 3) prompted investigation with computational orders of magnitude worse than the DOTA system. Inertness of chemistry methods. The largest La", smallest Lu", and selected non- selected Ph{Ln} chelates (Ln = Eu, Ho, Lu) was also tested under lanthanides (Ca", Li', Na', K) were compared in terms of the calculated transmetallation conditions with Zn" and Cu" ions (Supplementary Gibbs free energies of their open intermediate [M(L')] and bridged 1,5- Fig. 19). No reaction with Zn" and only a few percent of Cu chelate cz-[M(L')] and 1,4-cz-[M(L')] products. For all these metals there was a were observed after 1 week at 80 °C with 10-fold excess of these clear thermodynamic drive to both products, as expected for Huisgen metals, further confirming high inertness of the chelates even cycloaddition. The 1,5-isomer was favoured in all cases, except for the towards this mechanism of dechelation. large La" and K' ions (Supplementary Figs. 7 and 8). However, experi- mental results proved that even La" provided exclusively the 1,5-iso- Solid-state structures, isostructurality, isomerism mer (Fig. 1). This discrepancy was explained by considering the The striking differences in properties between the 1,5-triazole- and 1,4- reaction mechanism and kinetics. The transition state leading to the triazole-bridged chelates are best understood from their solid-state 1,5-triazole product was significantly lower in energy and therefore structures (Fig. 3). In the case of Ph{Lu}, the 1,5-triazole is part of an 18- kinetically preferred in both La" and Lu", in agreement with the membered ring, where all five donor N-atoms (three from cyclen, two experimental results. The reason seems to be partial de-coordination from pyridines) can coordinate tightly to the Lu" ion. On the other of the pyridines required for both transition states, which is more hand, the 1,4-triazole in 1,4-cz-[Lu(Ph L')] chelate increases the size of pronounced and energetically demanding for the 1,4-isomer (Supple- this ring to 19 atoms, bringing steric strain and chain conformations mentary Figs. 7 and 8, Supplementary Data 3). The peculiar case of that disfavour simultaneous coordination of both pyridines. This alkaline metals will be discussed next. mismatch explains why the 1,4-cz-[Ln(Ph L')] chelates are not pro- duced via the Click Zip reaction and are much less inert
/ Chemical Geology 217 (2005) 147-169 Table 7 concentration investigated in this study, a single Estimates of n obtained from the chloride dependence of the straight line was sufficient to fit the data (except for solubility data Nd at 150 C, where the data show significant scatter), Ln PO4 T (C) n implying a relatively constant value of n. Because the La PO4 23 0. 350. 08 ionic strength was not held constant as chloride 50 0. 830. 21 concentration was varied, the values of n given in Nd PO4 23 0. 240. 02 Table 7 include the non-specific effects of ionic 50 0. 630. 09 strength (i. e. , activity coefficients) in addition to the 150 2. 21. 9 23 Sm PO4 0. 480. 25 formation of chloride complexes. In the case of 50 0. 380. 31 reaction (3), increased ionic strength should favor YPO4 23 0. 410. 25 increased solubility from activity coefficient effects 50 0. 630. 26 alone. Thus, the values of n given in Table 7 overestimate the degree of complexation of the REE by chloride. calculated errors on the n values represent the standard error of the slope given by regression. Nevertheless, taking all these issues into account, analysis, and do not include errors resulting from the values of n for all the REE at 23 C indicate that the variation in ionic strength. In general, the value of the predominant species for all the REE investigated is the uncomplexed ion Ln3+, with a possible small n will not be constant as a function of chloride contribution from the first chloride complex Ln C12+. concentration if stepwise complexation occurs; it should increase with chloride concentration as the The fact that n appears to be constant (i. e. , a straight number of chloride ions bound to the Ln3+ ion. line fits the data well) suggests that the contribution of Ln Cl2+ is indeed very minor, and that the apparent increases. However, over the range of chloride teapparel T = 23C T=23C n = 0. 240. 02 n =0. 350. 08 Iog m H,PO4 Iog m H,PO4 5 4 -5 -6 I + PNw f l + c"u 6o\| / b) a) 8 -1. 0 -0. 5 0. 0 0. 5 1. 0 -1. 5 -0. 5 0. 0 0. 5 1. 0 -1. 5 -1. 0 Iog mc I log mc I 3 6 T = 23C T = 23C log m H,PO4 n =0. 480. 25 n = 0. 410. 25 f'Od`Hu 60I +^u f 4 -8 O -5 msm + Ic O 9 O O O -6 60 60\| -10 d) c) 11 -1. 5 -1. 0 -0. 5 0. 5 1. 0 -1. 5 -1. 0 -0. 5 0. 5 1. 0 0. 0 0. 0 log mc I Iog mc I Fig. 5. Representative plots of (logm1n+logmh,po. ) vs. logmci at 23 C for: (a) La; (b) Nd; (c) Sm; and (d) Y. These plots yield estimates of the value of n in Eq. (15) 163 Z. S. Cetiner et al. / Chemical Geology 217 (2005) 147-169 increase in solubility with chloride concentration at 23 by chloride in our experiments is relatively small. especially as the chloride concentration decreases. C may be a result of activity coefficient effects alone At 50 C, the values of n tend to increase, but they We carried out one final set of calculations to remain less than 1. 0. This possibly indicates an investigate the effect of chloride complexation on the increased proportion of Ln Cl2+, consistent with the. solubility of REE phosphates over the range of expected increase in stability of the chloride com- temperatures investigated in this work. Using the. plexes with increasing temperature. Nevertheless, the values of Ks3 for Nd PO4 at infinite dilution deter- Ln3+ ion still probably represents a significant. mined in this study, the stability constants determined proportion of the REE, especially at the lower. by Gammons et al. (1996) for Nd(IIl)-chloride chloride concentrations. The value of n for Nd at complexes, the Helgeson b equation for activity corrections, and the p H, total chloride, and H,PO4 150 C is significantly larger than at the lower. temperatures, but the uncertainty of this estimate is concentrations of our experiments, we calculated a quite large. Moreover, the data are not well fit by a theoretical concentration of Nd in each of our simple straight line when plotted as (logmin+. experimental solutions assuming equilibrium with log mh,po. ) vs. logmecr. There may be a problem. Nd PO4. These values are compared with the actual measured values in Table 8. It should be noted that with the measured phosphate concentrations for the ernr rrnne nnee ar ernnanne ee aae ee rrennnnner very similar results are obtained if the Nd(III) stability two orders of magnitude, whereas the Nd concen- constants of Migdisov and Williams-Jones (2002) are trations range over less than one order of magnitude used. This similarity is expected because the two sets of stability constants are in very good agreement. over the range of chloride concentrations investigated. At 25 C and 50 C, the calculated and measured Moreover, the Nd concentrations increase systemati- concentrations of Nd agree satisfactorily, given the cally with increasing chloride concentration, but the Cally una PDNIIOSI ee Satlslactonny, givenl the possible sources of error, even at the higher total. phosphate concentrations vary non-systematically (Table 3). It appears as although the phosphate chloride concentrations. The maximum deviation is a factor of three, with the measured values generally, concentrations for the 0. 1- and 1. 0-m experiments may be too high. The value of n depends on the but not always, greater than the calculated values. It is phosphate concentration as implied by Eq. (15), so also clear from these calculations that, at 25 C and 50 C, chloride complexes represent less (and in most any errors in the determination of phosphate concen-. tration would contribute to errors in the estimation of cases much less) than 50% of the total REE n. The results of Gammons et al. (1996) suggest that concentration. The abovementioned possible error in total measured phosphate concentration may account the average value of n between 0. 1 and 1. 0 mol kg chloride should be between 0 and 1. 0 at 150 C. Thus, for the much poorer agreement between calculated even at 150 C, the degree of complexation of Nd3+ and measured Nd concentrations at 150 C. A Table 8 Comparison of calculated and measured solubilities of Nd PO4(s) Temperature M Na C1 p Hm m Nd3+ m Nd Cl m Nd MH,PO9 m Nd Cl2+ m Nd measured calculated calculated calculated calculated 25 0. 1 1. 05 6. 98E-04 2. 42E-04 8. 11E-06 2. 50E-04 4. 05E04 8. 65E-04 0. 5 1. 05 3. 22E-05 3. 34E-04 3. 66E-04 4. 95E04 5. 05E-04 8. 61E-04 4. 36E-04 1 1. 05 6. 92E05 5. 37E04 5 1. 15 1. 07E-03 5. 00E-04 3. 62E04 8. 62E-04 6. 07E04 50 0. 1 1. 05 2. 17E-04 1. 24E-04 5. 56E06 1. 29E-04 2. 18E-04 1. 05 4. 13E-04 1 1. 49E-04 3. 09E05 1. 79E-04 3. 47E-04 8. 53E-04 5 1. 15 1. 02E-04 2. 09E-04 1. 07E04 6. 16E-04 150 0. 1 1. 05 1. 27E-05 2. 23E06 9. 03E-07 1. 74E-08 3. 15E-06 9. 96E07 7. 05E-07 0. 5 1. 05 4. 53E-06 1. 21E-05 1. 22E-05 2. 49E-05 2. 04E-06 1. 05 1. 89E-08 3. 37E-07 1 6. 05E-04 1. 24E-07 1. 95E-07 6. 28E-06 See text for details. 164 Z. S. Cetiner et al. / Chemical Geology 217 (2005) 147-169 potential problem with the measured total phosphate chloride concentration on the solubility of Nd phosphate at temperatures up to 300 C, using concentration is also indicated by the fact that, whereas the measured Nd concentration increases currently available thermodynamic data. In the previous paragraphs of this section, we have steadily with increasing chloride concentration, the provided a number of lines of evidence to suggest calculated Nd concentration increases from 0. 1 to 0. 5 that, at the temperatures and chloride concentrations m chloride, but then drops to a much lower value at 1. 0 m chloride
6H,O Method/Apparatus/Procedure: at all temperatures; its density was determined to be Isothermal method with analysis of the saturated solutions was used. The components were equilibrated in glass containers with continuous stirring 2. 491 g cm-3 and molar volume 149. 8 cm. mol-1 at an un- in a cryostat for 10-12 d. Weighed samples of the saturated solutions. specified temperature. were withdrawn with a syringe and analyzed for Tb content by titration with EDTA solution. The reported solubility values are mean results of Auxiliary Information. repeated measurements. Method/Apparatus/Procedure: Source and Purity of Materials: Isothermal method with chemical analysis of the equilibrium phases was Tb Cl, - 6H,O was prepared by dissolution of the corresponding oxide used. The components were equilibrated for 3-10 d in a thermostat with (99. 9+% pure) in HCl solution (of special purity). The product was twice continuous agitation of the mixtures. At low temperatures, equilibrium recrystallized from HCl solution and then from water. It was air dried at was reached within 6-8 d. Content of Tb in the separated phases was 30 C and analyzed for Tb and Cl contents. determined by titration with EDTA solution using xylenol orange indicator. The determinations were repeated five to ten times. Densities of. Estimated Error: indicator. The determinations were repeated five to ten times. Densities of Estimated Error: the solutions as well as of the solid hexahydrate were determined with a Solubility: precision of 2%. pycnometer. The hexahydrate density was measured by means of Temperature: precision of 0. 5 K. anhydrous toluene. Source and Purity of Materials: Original Measurements: Components: Tb Cl-6HO was prepared by dissolution of the corresponding oxide 36N. P. Sokolova, Zh. Neorg. (1) Terbium chloride; Tb Cl3; (99. 9+% pure) in HCl solution (of special purity). The reaction product [10042-88-3] Khim. 28, 782 (1983). was twice recrystallized from HCl solution and then from water. The (2) Water; H,O; [7732-18-5] crystals were dried in air at 30 C. The salt composition was checked: Tb by complexometric titration and Cl by the method of Volhard. Water Variables: Prepared by: content was found by difference. Composition: 0-68 mass % T. Mioduski and C. Guminski Tb Cl3 Estimated Error: Solubility: nothing specified. Temperature: precision of 0. 1 and 1 K at 0 C. Experimental Values Density: precision of 0. 003 g cm-3. Melting temperatures of Tb Cl,-HO mixtures as read from a figure and recalculated to molalities and mole fractions by the compilers Components: Original Measurements: 19A. V. Nikolaev, A. A. Sorokina, (1) Terbium chloride; Tb Cl3; 100w1 t/C Equilibrium solid phase m x1 N. P. Sokolova, G. S. [10042-88-3] H,O(s) (2) Water; H,O; [7732-18-5] Kotlyar-Shapirov, and L. I. 0. 0110 14. 2 0. 62 9- Bagryantseva, Izv. Sibir. Otd. 25. 3 1. 28 -16 0. 0225 H,O(s) Akad. Nauk SSSR, Ser. Khim. 34. 3 0. 0343 -31 H,O(s) 1. 97 Nauk (1), 46 (1978). 42. 5 0. 0479 2. 79 -48 H,O(s) +Tb Cl; 15HO 45. 5 3. 15 0. 0537 28 Tb Cl 15H,O+Tb Cl9H,O Variables: Prepared by: 47 3. 34 0. 0568 -20 Tb Cl, 9H,O+Tb Cl, -6H,O Temperature: 258-268 K T. Mioduski and C. Guminski 0. 0580 47. 6 3. 42 -11 Tb Clz -6HO Because eutectic thermal arrests were observed also in the field between Tb Cl 15H,O phase diagram and Tb Cl,. 9H,O, it is possible that an extra transformation of Tb Cl: 15H,O occurs at a temperature similar to the eutectic temperature. J. Phys. Chem. Ref. Data, Vol. 38, No. 4, 2009 s at: [URL] and permissions Downloaded 11 Sep MIODUSKI. GUMINSKI. AND ZENG 956 Auxiliary Information Composition of saturated solutions in the ternary Tb Clz-C,H,NO HCl-H,O system at 25 and 50 C Method/Apparatus/Procedure: Differential thermal analysis between -120 C and room temperature was ma t/C ma Equilibrium solid phaseb 100w1 100w2 performed. According to the earlier paper,109 the samples were prepared in 38. 0 4. 77 32. 0 10. 9 B+C sealed glass ampoules. The heating rate was 0. 2-0. 5 K min-'. The heating 37. 5 4. 22 29. 0 8. 88 c curves were recorded with a chromel/copel thermocouple. 39. 0 3. 68 21. 0 5. 38 c Source and Purity of Materials:d 43. 0 3. 60 12. 0 2. 73 c As in Ref. 109, Tb Cl-6HO was prepared by dissolution of the 50. 5 3. 85 0 0 c corresponding oxide (99. 9% pure) in excess of HCl solution. The product was twice recrystallized from HCl solution (very pure) and finally from amolalities calculated by the compilers water. b A=C,H,NO HCl; B=Tb Cl, 3C,H,NO 3HCl-5H,O; C=Tb Cl6H,O Estimated Error: The compound B was found to be congruently soluble. Its Solubility: nothing specified; reading-out procedure of +0. 5 mass %. Temperature: nothing specified; reading-out procedure of 0. 5 K. solubility was determined to be 83. 3 and 86. 1 mass % at 25 and 50 C, respectively. The melting points of the com- pounds A, B, and C were found to be 70, 60, and 155 C, 3. 3. Tb Cl3-Organic Compound-H,O Systems respectively. Auxiliary Information Original Measurements: Components: 65E. F. Zhuravlev, R. K. (1) Terbium chloride; Tb Cl3; Method/Apparatus/Procedure: Gaifutdinova, and Kh. G. [10042-88-3] The method of isothermal sections of the phase diagram with (2) Ethanolamine hydrochloride;. Zainullina, Zh. Neorg. Khim. 26 refractometric analysis of the solutions was used. Known amounts of the 2-aminoethanol 1651 (1981). components were equilibrated until refractive indices of the liquid phases hydrochloride; C,H,NO HCl; were constant. Compositions of the saturated solutions and the [2002-24-6] corresponding solid phases were found from inflection points on plots of (3) Water; H,O; [7732-18-5] the refractive index versus composition. The refractive indices were measured in a thermostated refractometer. Composition of the double salt Variables: Prepared by: B was confirmed by chemical analysis for contents of N, Cl, C, H, and Tb T. Mioduski and C. Guminski. Composition of mixtures (Tb by the oxalate method and by complexometric titration). Thermal Temperature: 298 and 323 K analysis of the compounds was carried out with the use of a Kurnakov. pyrometer. Experimental Values Source and Purity of Materials:. Composition of saturated solutions in the ternary Tb Cl, 6H,O was prepared by dissolution of the corresponding oxide. Tb Clz-C,H,NO HCl-H,O system at 25 and 50 C (chemically pure) in HCl solution (chemically pure). Analysis of the crystal product for Cl content confirmed the formula of the hexahydrate. ma 100w 100w2 Equilibrium solid phaseb m2a t/C C,H,NO-HCl was prepared by neutralization of the amine with HCl solution. The resulting solution was evaporated and the crystals. 30. 0 25 0 0 74. 5 A recrystallized. 0. 68 70. 5 28. 9 4. 5 A Estimated Error: 29. 0 66. 5 A 10. 0 1. 60 Solubility: nothing specified. 14. 5 2. 48 63. 5 29. 6 A Temperature: precision in thermal analysis of 5 K. 22. 0 4. 61 60. 0 34. 2 A+B 23. 0 58. 0 4. 56 31. 3 B 27. 0 4. 07 48. 0 19. 7 B 28. 0 46. 0 22. 5 B 5. 03 Components: Original Measurements: 31E. F. Zhuravlev, R. K. 31. 0 4. 17 41. 0 15. 0 B (1) Terbium chloride; Tb Cl3; Gaifutdinova, D
, 1999. Modeling of Diffusion in a Micro -Cracked Composite Laminate Using Approximate Solutions. Journal of Composite Materials 33, 872 -905. Ilankoon, I. M. S. K. , Neethling, S. J. , 2016. Liquid spread mechanisms in packed beds and heaps. The separation of length and time scales due to particle porosity. Miner als Engineering 86, 130 -139. Bailey, A. D. , Hansford, G. S. , 1993. Factors affecting bio ‐oxidation of sulfide minerals at high concentrations of solids: A review. Biotechnology and Bioengineering 42, 1164 -1174. Journal Pre-proof Journal Pre-proof Wong, J. W. C. , Xiang, L. , Chan, L. C. , 2002. p H Requirement for the Bioleaching of Heavy Metals from Anaerobically Digested Wastewater Sludge. Water, Air, and Soil Pollution 138, 25 -35. Yin, W. Z. , Tang, Y. , Ma, Y. Q. , Zuo, W. R. , Yao, J. , 2017. Comparison of sample properties and leaching characteristics of gold ore from jaw crusher and HPGR. Minerals Engineering 111, 140 -147. Journal Pre-proof Journal Pre-proof Highlights  Ore particles of the same size fraction but with different number of micro -cracks were prepared.  The influence of micro -cracks on the activities of bacteria was investigated.  An improve d approach to extract copper from low -grade copper ores by bioleaching was reported. Journal Pre-proof Journal Pre-proof
Coupling between IX, in which the oxygen level is brought back to light transfer and growth kinetics. Biotechnol. Bioeng. 40, non limiting conditions (40%). In this case, com- 817-825. partment II recovers complete nitrification per- Cornet, J. F. , Dussap, C. G. , Cluzel, P. , Dubertet, G. , 1992b. A structured model for simulation of cultures of the cyano- formance, and nitrite concentration decreases at bacterium Spirulina platensis in photobioreactors: II. Iden- the outlet of compartment IVa, following precisely tification of kinetic parameters under light and mineral the wash-out curve. limitations. Biotechnol. Bioeng. 40, 826N-834N. 330 F. Godia et al. I Journal of Biotechnology 99(2002） 319-330 Cornet, J. F. , Dussap, C. G. , Gros, J. B. , 1998. Kinetics and spectives. Proceedings of the 30th International Conference energetics of photosynthetic micro-organisms in photobio- on Environmental Systems, Toulouse, France. reactors. Adv. Biochem. Eng. /Biotechnol. 59, 153-224. Mergeay, M. , Verstraete, W. , Dubertret, G. , Lefort-tran, M. , Eckart, P. , 1994. Life Support and Biospheric. Herbert Utz Chipaux, C. , Binot, R. , 1988. MELISSA. A microorganisms Publisher, Munchen, Germany. based model for CELSS development. Proceedings of the Fulget, N. , Poughon, L. , Richalet, J. , Lasseur, C. h. , 1999. 3rd symposium on space thermal control and life support MELISSA: global control strategy of the artificial ecosys- systems. Noordwijk, The Netherlands. tem by using first principles models of the compartments. Nogueira, R. , Lazarova, V. , Manem, J. , Melo, L. F. , 1998. Adv. Space Res. 24, 397-405. Influence of dissolved oxygen on the nitrification kinetics in Gustavino, S. R. , Fadden, C. D. , Davenport, R. J. , 1994. Con- a circulating bed biofilm reactor. Bioprocess Eng. 19, 441- cepts for advanced waste water processing systems. Pro- 449. Tamponet, C. , Savage, C. , Amblard, P. , Laserre, J. C. , Per- ceedings of the 24th International Conference on sonne, J. C. , Germain, J. C. , 1999. Water recovery in space. Environmental Systems, Friedrichshafen, Germany. Society of Automotive Engineering Technical paper 941500. ESA Bul1. 97,56-60. Tamponnet, C. , Savage, C. , 1994. Closed ecological systems. J. Hendrikus, J. , Laambroek, H. J. , Gerards, S. , 1993. Competi- Biol. Educ. 28, 167-173. tion for limiting amounts of oxygen between Nitrosomonas Vernerey, A. , Albiol, J. , Lasseur, C. , Godia, F. , 2001. Scale-up europaea and Nitrobacter winogradsky grown in mixed and design of a pilot-plant photobioreactor for the con- cultures. Microbiology 159, 453-459. tinuous culture of Spirulina platensis. Biotechnol. Progr. 17, Joo, S. -H. , Kim, D. -J. , Yoo, I. -K. , Park, K. , Cha, G. -C. , 2000. 431-438. Partial nitrification in an upflow biological aerated filter by Vrati, S. , 1984. Single cell protein production by photosynthetic O2 limitation. Biotechnol. Lett. 22, 937-940. bacteria grown on the clarified effluents of a biogas plant. Lasseur, C. , Dixon, M. , Dubertret, G. , Dussap, G. , Godia, F. , Appl. Microbiol. Biotechnol. 19, 199-202. Gros, J. B. , Mergeay, M. , Richalet, J. , Verstraete, W. , 2000. Wijffels, R. H. , Tramper, J. , 1995. Nitrification by immobilized MELISSA: 10 years of research, results, status and per- cells. Enzyme Microb. Technol. 17, 482-492
a thiol-molecule/Cd²+ ratio of 2 at 100 μM or higher external Cd Cl, concentrations, physiological p H should suffice for complete the thiol-molecules/cadmiumacumulated ratio is <2, metal ion inactivation. However, at neutral p H indicating insufficient Cd2+ binding by thiol-mol- the Cd-2PC2 is also formed (approximately 30% ecules; since this is not accompanied by marked of total metal complexes), in which three cell toxicity, it is expected that other chelating (Fig. 6. 1c) or four thiol groups (Fig. 6. 1d) coordi- molecules and mechanisms are involved in Cd2+ nate the metal ion; at p H higher than 7 this last neutralization. complex prevails, and hence the thiol-molecule/ The cadmium accumulation in E. gracilis is cadmium ratio could also be 4 for reaching com- 33 times higher than in the green microalgae plete metal ion inactivation. Chlamydomonasacidophila and Chlamydomonas On the other hand, the intracellular zinc content reinhardtii (Garcia-Garcia et al. 2012; Mendoza- reaches a maximum of approximately 240- Cozatl et al. 2002, 2006a; Nishikawa et al. 2006; 320 nmol/10’ cells in E. gracilis cultured with Santiago-Martinez et al. 2015). This ability makes 300-1000 μM Zn Cl, for at least ten cell genera- E. gracilis a Cd-hyperaccumulator microorganism tions (i. e. , two subcultures); higher external Zn Cl2 because its cadmium accumulation capacity concentrations do not lead to greater intracellular (1. 1-4. 4 mg or 9. 5-39 μmoles/g DW (Garcia- zinc levels. At 300-400 μM Zn Cl2, the thiol-mole- Garcia et al. 2012; Mendoza-C6zatl et al. 2002. cule/zincacumulaed ratio is 0. 2, clearly indicating 2006a; Santiago-Martinez et al. 2015)) exceeds insufficient formation of thiol-molecules for han- the respective standard reference for cadmium in dling Zn. + stress. However, these elevated intra- Cd-hyperaccumulator plants (0. 1 mg/g DW) cellular zinc levels do not affect cell functions (Ali et al. 2013; Bhargava et al. 2012). (Sanchez-Thomas et al. 2016). E. gracilis can also It is worth recalling that for binding and full be considered as a Zn-hyperaccumulator microor- inactivation of Cd. +, four interacting electronega- ganism because its zinc accumulation capacity tive groups are required (Belcastro et al. 2009). reaches 2. 2-3 mg (34. 7-46. 1 μmoles) zinc/g DW At physiological GSH concentrations and p H, (Sanchez-Thomas et al. 2016), which is close to Cd2+ spontaneously, rapidly and predominantly the standard reference concentration for Zn. + in forms Cd-bis-glutathionate (GS-Cd-GS or Zn-hyperaccumulator plants (3. 0 mg zinc/g DW; Cd-GS2; Fig. 6. 1a), in which a tetrahedral coordi- Ali et al. 2013). Fig. 6. 1 Molecular interactions of GSH and phytoche- bond between Cys2 and Gly and the carboxylate group latin 2 (PC2) with Cd2+. (a) The predominant complex from Gly. (c) In the presence of higher amounts of PC2, formed between GSH and Cd’+ is constituted by two GSH Cd2+ is bound by the two thiol groups from Cys, and Cys2 molecules and one Cd. + ion. The two thiol groups and two and the carboxylate group of Gly of one PC2 molecule, water molecules establish the interaction with the divalent and one thiol group of a second PC2. (d) Another stable metal ion (Delalande et al. 2010). (b) At equimolar con- structure is the interaction of Cd2+ with the four thiol centrations, and neutral p H, Cd2+ is bound by two thiol groups of two PC2 molecules at p H > 7. Structures were groups from Cysi and Cys2, which upon binding release depicted using the physicochemical analysis described by their hydrogens as H+, and by two oxygens from the peptide Dorcak and Krezel (2003) Biochemistry and Physiology of Heavy Metal Resistance and Accumulation in Euglena 99 A NH3 Glu1 Cys1 Glu2 Cys2 Gly COO D NH3 Co O- 100 R. Moreno-Sanchez et al. In summary, the ability of E. gracilis to accu- glycine metabolism (Mendoza-Cozatl et al. mulate heavy metals depends at least partially on 2005). The sulfur assimilation pathway synthe- the formation of complexes with Cys, GSH, and sizes Cys, which is a precursor for methionine, phytochelatins in a thiol-molecule/metal ratio of GSH and protein syntheses (Koprivova and at least 2; and their subsequent compartmental- Kopriva 2014; Zheng et al. 2015). Plasma mem- ized into chloroplasts (Mendoza-Cozatl et al. brane sulfate transporters catalyze the first reac- 2006b) and probably mitochondria (Avilés et al. tion in the sulfur assimilation pathway. 2003), as E. gracilis lacks typical plant-like vacu- oles (Rocchetta et al. 2006; Sittenfeld et al. 2002; Sulfate transporters. The plasma membrane sulfate Sommer and Blum 1965). The stoichiometry for transporters are classified by their substrate affin- heavy metal complexation with sulfide is one, ity as high affinity sulfate transporters with Km resulting in the formation of insoluble salts (Cd S values for sulfate <100 μM, and low affinity sulfate and Zn S solubilities in water are 0. 13 andt transporters with Km values >100 μM (Garcia- 0. 6 mg/100 m L, respectively). Sulfide can also be Garcia et al. 2016; Mendoza-Cozatl et al. 2005). synthesized by E. gracilis (see Sect. 6. 3. 2. 2). The plasma membrane sulfate transporter activi- Therefore, these features place E. gracilis as one ties are perturbed by ionophores in E. gracilis, C. of the best candidates to be applied in the biore-reinhardti and Chlorella ellipsoidea (Garcia- mediation of water bodies polluted with Cd. + and Garcia et al. 2012; Matsuda and Colman 1995; Zn2+. When the thiol-molecule/metal ratio cannot Yildiz et al. 1994), because the uptake reaction is reach a value of 2 (i. e. , at high heavy metal con- an electrogenic process (co-transport of 3 H+ and centrations), E. gracilis may still exhibit signifi- 1 sulfate molecule; Fig. 6. 2) in which the H+ cant cell growth. Thus, other intracellular gradient is generated by a plasma membrane H+- mechanisms of metal inactivation and accumula- ATPase activity. Oxidative phosphorylation tion most likely become involved such as the seems the main contributor to ATP supply for transcriptional and biochemical activation of the sulfate uptake in C. reinhardti, C. ellipsoidea, E. polyphosphates (Poly P) and organic acid biosyn- gracilis and Rhodella maculata; while the photo- theses (see Sects. 6. 3. 3 and 6. 3. 4). synthesis inhibitor 3-(3,4-dichlorophenyl)-1,1- dimethylurea partially disrupts the sulfate uptake 6. 3. 2. 2 Sulfur Assimilation Pathway in E. gracilis and R. maculata (Garcia-Garcia The backbone of the phytochelatins metabolism et al. 2012; Matsuda and Colman 1995; Millard (Fig. 6. 2) comprises the sulfur assimilation path- and Evans 1982; Yildiz et al. 1994). way (SAP; from extracellular sulfate to Cys), The plasma membrane sulfate transport has GSH biosynthesis, phytochelatins biosynthesis been considered a control step of Cys synthesis and Cd-phytochelatin complexes formation, because the transporter activities are significantly transport and storage into vacuoles in plants and lower than those of all other enzymes of the sul- yeasts, and into chloroplasts and mitochondria in fur assimilation pathway, and GSH and phyto- E. gracilis as this protist does not have typical chelatins syntheses (Table 6. 3); thus, several vacuoles but it has minivacuoles (Rocchetta et al. groups have focused on studying their regulation 2006; Sittenfeld et al. 2002; Sommer and Blum mechanisms. For instance, under sulfate defi- 1965). Because phytochelatins metabolism con-( ciency, the high-affinity plasma membrane sul- sumes ATP and NADPH (eight high-energy fate transporters increase their activity in the bonds and eight NADPH molecules are used to green microalgae C. reinhardti (Yildiz et al. synthesize one PC2 molecule from sulfate, gluta- 1994) and C
2013;41:D636-47. 35 [31] Meyer BH, Zolghadr B, Peyfoon E, Pabst M, Panico M, Morris HR, et al. [43] Yarzabal A, Brasseur G, Ratouchniak J, Lund K, Lemesle-Meunier D, 76 36 Sulfoquinovose synthase - an important enzyme in the N-glycosylation De Moss JA, et al. The high-molecular-weight cytochrome c Cyc2 of 77 37 pathway of Sulfolobus acidocaldarius. Mol Microbiol 2011;82:1150-63. Acidithiobacillus ferrooxidans is an outer membrane protein. J Bacteriol 78 38 [32] Okibe N, Gericke M, Hallberg KB, Johnson DB. Enumeration and 2002;184:313-7. 79 39 characterization of acidophilic microorganisms isolated from a pilot 80 40 81 41 82 Please cite this article in press as: Talla E, et al. , Insights into the pathways of iron- and sulphur-oxidation, and biofilm formation from the chemolithotrophic acidophile Acidithiobacillus ferrivorans CF27, Research in Microbiology (2014), [URL]
Garbometer: A methodology for comprehensive evaluation of municipal solid waste management systems. Proceedings of ISWA World Congress 2013, 7-11 October, Vienna, Austria. Vienna: International Solid Waste Association (ISWA). Polaz, C. N. M. & B. A. N. Teixeira (2009). Indicadores de sustentabilidade para a gestão municipal de resíduos sólidos urbanos: Um estudo para São Carlos [Indicators of sustainability for municipal solid waste management: Case study of the city of São Carlos]. In Portuguese. Engenharia Sanitaria e Ambiental, 14(3), 411-420. Regions4Recycling (2014). Regions for Recycling: R4R Toolkit and Methodology. [URL] eu/R4R_toolkit/R4R_methodology Romualdo J. C. (2014). Development and testing of an indicator set to benchmark the performance of a national hazardous waste management system (MSc thesis). Imperial College London. Ronconi, M. (2001). The Development of Waste Indicators at European Union Level: Some Recent Eurostat Experiences. Working paper 29 to a joint ECE/ Eurostat Work Session on Methodological Issues in Waste Statistics. Statistical Commission and Econonmic Commission for Europe (ECE), Commission of the European Communities, Conference of European Statisticians and Eurostat. [URL] SWEEPNet (2014). Challenges and Opportunities for Solid Waste Management in the Mashreq and Maghreb Region. Sweepnet - The Regional Solid Waste Exchange of Information and Expertise network in Mashreq and Maghreb countries. [URL] UNSD (United Nations Statistics Division). (2013). Framework for the Development of Environment Statistics 2013. [URL] Wilson, D. C. , L. Rodic, M. J. Cowing et al. (2015). ‘Wasteaware’ benchmark indicators for integrated sustainable waste management in cities. Waste Management, 35 (1), 329-343. doi:10. 1016/j. wasman. 2014. 10. 006 Wilts, H. (2012). National waste prevention programs: Indicators on progress and barriers. Waste Management & Research, 30((9) Supplement), 29-35. Zaman, A. U. & S. Lehmann (2013). The zero waste index: A performance measurement tool for waste management systems in a ‘zero waste city’. Journal of Cleaner Production, 50, 123-132. Materials flow analysis Baccini, P. & P. H. Brunner (2012). Metabolism of the Anthroposhere - Analysis, Evaluation, Design. 2nd Edition. Cambridge, Massachusetts, U. S. : The MIT Press. Bringezu, S. (1997). Material flow indicators. In Moldan, B. and S. Billharz (Eds. ) Sustainability indicators. New York: John Wiley & Sons Ltd. , 168-176. Cleveland, C. J. & M. Ruth (1998). Indicators of Dematerialization and the Materials Intensity of Use. ” Journal of Industrial Ecology 2(3), 15-50. Hinterberger, F. , E. Luks & F. Schmidt-Bleek (1997). Material flows vs. “natural capital”: What makes an economy sustainable. Ecological Economics (23), 1-14. Loppolo, G. , R. Heijungs, S. Cucurachi et al. (2014). Urban Metabolism: Many Open Questions for Future Answers. In Salomone, R. & G. Saija (Eds. ) Pathways to Environmental Sustainability, Springer, 23-32. Pincetl, S. , P. Bunje & T. Holmes (2012). An expanded urban metabolism method: Toward a systems approach for assessing urban energy processes and causes. Landscape and Urban Planning, 193-202. Schmidt-Bleek, F. (1994). Revolution in resource productivity for a sustainable economy - a new research agenda. Fresenius Environmental Bulletin (2): 245-490. UNEP and CSIRO (2011). Resource Efficiency: Economics and Outlook for Asia and the Pacific. [URL] unep. org/publications/pmtdocuments//pdf/Resource_Efficiency_EOAP_web. pdf. UNEP and CSIRO (2013). Recent Trends in Material Flows and Resource Productivity in Asia and the Pacific. [URL] Global Waste Management Outlook West, J. , H. Schandl & S. Heyenga (2013). Resource Efficiency: Economics and Outlook for China. UNEP , CSIRO and IPM. ISBN 13:9789280733181. [URL] Chinese_2013. pdf Topic sheets Waste prevention Brook Lyndhurst for DEFRA (2009). WR1204 Household Waste Prevention Evidence Review: L1m1 – Executive Report. A report for Defra’s Waste and Resources Evidence Programme. Cox, J. , S. Giorgi, V. Sharp et al. (2010). Household waste prevention - A review of evidence, Waste Management and Research, 28(3): 193-219. EEA (European Environment Agency). (2013b). Waste prevention in Europe - the status in 2013, EEA Report No 9/2014. [URL] Sabogal, N. (2013). Cartagena Declaration on the Prevention, Minimization and Recovery of Hazardous Wastes and Other Wastes, Proceedings of the Eighth International Conference on Waste Management and Technology, Towards Ecological Civilization, Shanghai, China, October 23-25, 2013. UK, DEFRA (UK Department for Environment, Food & Rural Affairs). (2012). Business Waste Prevention Evidence Review – WR1403. [URL] Wilson, D. C. , D. Parker, J. Cox et al. (2012). Business waste prevention: A review of the evidence, Waste Management and Research, 30(9 SUPPL. 1): 17-28. Wilts, H. , G. Dehoust, D. Jepsen et al. (2013). Eco-innovations for waste prevention – Best practices, drivers and barriers. Science of the Total Environment, 461-462: 823-829. Sustainable consumption and production Clement, S. (Ed. ). (2007). The Procura+ Manual. A Guide to Cost-Effective Sustainable Public Procurement. 2nd edition. ICLEI – Local Governments for Sustainability. [URL] European Commission (EC). (2011b). Proposal for a Directive of the European Parliament and of the Council on Public Procurement, COM(2011) 896 Final, Brussels, 2011. [URL] Georghiou, L. , J. Edler, E. Uyarra et al. (2013). Policy instruments for public procurement of innovation: Choice, design and assessment, Technological Forecasting and Social Change. [URL] Lorek, S. & D. Fuchs (2013). Strong sustainable consumption governance – Precondition for a degrowth path. Journal of Cleaner Production 38: 36-43 Mc Donough, W. & M. Braungart (2002). Cradle to Cradle: Remaking the Way We Make Things. North Point Press, New York, U. S. Mc Donough, W. & M. Braungart (2013). The Upcycle: Beyond Sustainability – Designing for Abundance. North Point Press, New York, U. S. Tukker, A. , S. Emmert, M. Charter et al. (2008). Fostering change to sustainable consumption and production: An evidence based view, Journal of Cleaner Production 16(11): 1218-1225. UNEP (2009b). Design for sustainability: Step-by-step approach. [URL] Various other interesting publications on design for sustainability can be found at : [URL] UNEP (2012d). Global Outlook on Sustainable Consumption and Production Policies. Taking action together. [URL] Various other useful UNEP publications on this topic can be found at [URL] UNEP/Wuppertal Institute Collaborating Centre on SCP , with the Stockholm Environment Institute (2010). What public policy framework is required to encourage sustainable consumption business strategies. Annex A: Further resources[URL] Consumption_Policy_Instruments. pdf USEPA (U. S. Environmental Protection Agency). (n. d. ). The Revised (Draft) Guidelines for Product Environmental Performance Standards and Ecolabels for Voluntary Use in Federal Procurement. [URL] Small Island Developing States (SIDS) ADB (2014) Solid Waste Management in the Pacific – Financial Arrangements [URL] default/files/publication/42656/solid-waste-management-financial-arrangements. pdf and [URL] environment. gov. ki/. page_id=37 Secretariat of the Pacific Regional Environment Programme (SPREP). Regional Strategies on Hazardous waste and solid waste, Case studies. [URL] SIDS Accelerated Modalities of Action (S. A. M. O. A. ) Pathway [URL] Stock, P. (2014). Island Innovations – UNDP and GEF: Leveraging the Environment for the Sustainable Development of Small Island Developing States. UNDP. [URL] UNDP_WS_Island Innovations_UNDP_GEF_Leveraging_the_Env. pdf UNEP (2012f)
The solution was filtered after To prove the feasibility of the cycle, several experi- the bioleaching process was accomplished. Cu2+ in the ments were designed. 100 m L of adjusted 9K medium leachate was separated by displacement of iron power. was oxidized by bacteria first. And then, the supernatant Finally, the solution was diluted to the concentration was used to leaching 15 g/L PCBs. After the leaching pro- of 15 g/L Fe2+ for the bacterial oxidation again. Totally, cess was accomplished, the solution was filtered. Then, 100 g/L of PCBs were disposed with nine times of cycles. Cu2+ in the solution was separated by displacement of The tactic was as follows: the addition of PCBs was 15 g/L Wu et al. Bioresour. Bioprocess. (2018) 5:10 Page5of 13 at the first 4 cycles and 10 g/L at the next 4 cycles, and to the consumption of ferric iron in bacteria-free cul- 0 g/L PCBs at the last cycle for completely reaction. Sam- tural supernatant. In addition, the consumption of Fe3+ ples were collected to analyze p H, Eh, and the concentra- is shown in Fig. 2d. After 2 h, the content of ferric iron tions of Fe2+, Fe3+, and Cu2+. in the solution had been reduced to a low level under the condition of 15 g/L PCBs. Therefore, the residual copper Analytical methods in the PCBs could not be dissolved quickly. The p H and redox potential was measured by a p H meter To verify that the oxidation of Fe3+ was the predomi- and Eh meter (Mettler model FE20). The concentration of nant mechanism of the copper extraction from PCBs by ferrous iron was determined by titration with potassium bacteria-free cultural supernatant, ferric sulfate solution, dichromate in the presence of the indicator N-phenylan- bacteria-free cultural supernatant, pure water, and pure thranilic acid. Copper ion concentration was determined media were used to leach 15 g/L PCBs, and the result by atomic absorption spectrometer (Analytic Jena AG, is shown in Fig. 3. There was a little copper extracted Germany). The concentration of Fe3+ was determined by by pure water and pure medium in the initial p H of 1. 2, the titration of EDTA at p H 2 in the presence of sulpho- which indicated that in this process, the role of acid salicylic acid as an indicator. All experiments were done leaching was not significant. However, the copper recov- in orbital shaker incubators. ery of bacteria-free cultural supernatant and ferric sulfate solution was similar and much higher than that of pure Results and discussion water and pure medium which confirmed that the copper Copper extraction from PCBs using bacteria-free cultural in PCBs was dissolved by the oxidation of Fe3+. The result supernatant indicated that the indirect non-contact mechanism was A microbial consortium which Leptospirillum ferriphi- the predominant mechanism in bioleaching of copper lum and Sulfobacillus thermosulfidooxidans were the from PCBs. It was also demonstrated that there was no predominant organisms was used to produce the super- need for bacteria to contact with PCBs for the extraction natant. The microbial consortium had been adapted in of copper. In addition, the role of bacteria in bioleaching metal-contained medium for several years. In addition, of PCBs was most likely to regenerate Fe3+ as oxidant. the metal tolerance of the species in the literature and Jadhav and Hocheng (2013) investigated silver extraction the microbial consortium used in this paper are shown in from spent silver oxide-zinc button cell battery using Table 2. It was indicated that the mixed culture used in Acidithiobacillus ferrooxidans, and considered indirect this study had stronger metal tolerance. non-contact leaching was the predominant mechanism Figure 2 shows the leaching results of copper from for metal solubilization. Kim et al. (2005) demonstrated PCBs by bacteria-free cultural supernatant. As shown indirect non-contact leaching performed better than in Fig. 2a, the addition of PCBs would cause the rise of direct leaching in bioleaching of cadmium and nickel p H. It indicated that the PCBs was alkaline, and the result from synthetic sediments. was consistent with Yang et al. (2009) and Arshadi and Mousavi (2014). Figure 2c demonstrates that the leach- The toxic effect of PCBs on bacterial oxidation activity ing reactions mainly occurred at the first 2 h. In addi- It had been confirmed in the “Copper extraction from tion, almost 100% copper was dissolved by bacteria-free PCBs using bacteria-free cultural supernatant" sec- cultural supernatant when adding 5 g/L PCBs. The result tion that the chemical-leaching process (Eq. 2) could be indicated that the copper in the PCBs was released due directly achieved by bacteria-free cultural supernatant. to chemical oxidation by ferric ion. During the chemi- However, the bacteria were required to participate in the cal oxidation process, Fe3+ (strong oxidizing agent) was biooxidation of Fe2+ to Fe3+ (Eq. 1). To obtain the opti- constantly converted to Fe2+, and it was confirmed by mum oxidation rate of bacteria (without PCBs), growth Fig. 2b. In addition, with the amount of PCBs increasing. conditions of the mixed bacteria used in the experiment the recovery of copper gradually decreased. It was related were optimized (data not show). Finally, the optimum Table 2 Range of metal tolerance of different kinds of bacteria Reference Bacteria The maximum metal concentration whereby metabolic activity still occurs Tian et al. (2007) L. ferriphilum Ni2+(30-40 m M), Zn2+(20-30 m M), Co2+ (5-10 m M), Cu2+ (< 5 m M) and Cd2+ (< 5 m M) Dopson et al. (2003) S. thermosulfidooxidans 6 m M Cu2+,43 m M Zn2+,and 5 m M Ni2- Hallmann et al. (1992) L. ferrooxidans AI3+ (278 m M), Co2+ (17. 0 m M), Cu2+ (391 m M), Mn2+ (546 m M), Ni2+ (127 m M),and Zn2+ (461 m M) Current work Microbial consortium AI3+ (1049 m M), Zn2+ (1046 m M), Ni2+ (681 m M) and Cu2+ (781 m M) Wu et al. Bioresour. Bioprocess. (2018) 5:10 Page 6 of 13 a b 1. 9 5g/LPCB 5g/LPCB 10g/L PCB 1. 8 10g/LPCB 15g/L PCB 15g/L PCB 1. 7 10 1. 6- 1. 5- 1. 4 1. 3- 1. 2 1. 1 0. 0 0. 5 1. 0 1. 5 2. 0 2. 5 3. 0 3. 5 0. 0 0. 5 1. 0 1. 5 2. 0 2. 5 3. 0 4. 0 Time(h) Time(h) d C +—5g/LPCB 100- —10g/LPCB 15g/LPCB 80 (%) 60 40 5g/LPCB 20 10g/LPCB 15g/LPCB 0. 0 0. 5 1. 0 1. 5 2. 0 2. 5 3. 0 3. 5 4. 0 4. 5 0. 0 2. 0 2. 5 3. 0 3. 5 4. 0 Time(h) Time(h) Fig. 2 Time period evaluation of p H (a), Fe2+ ( concentration(b), concentration (d) in leaching of copper from PCBs by bacteria-free cultural supernatant biooxidation rate was obtained at the initial p H of 0. 9, the that the oxidation of ferrous ions by bacteria was an acid- temperature of 32 °C and the initial Fe2+ concentration consuming process. When the amount of the PCBs was of 15 g/L. As shown in Fig. 4c, the complete biooxidation increased, more ferric ions were required to be produced of 15 g/L Fe2+ required 24 h in 0 g/L PCBs, and the rates by bacteria to leaching copper from PCBs. Therefore, of consumption of Fe2+ were 0. 5833 g/L h. However, as more acid was consumed. (2) The PCBs was alkaline in shown in Fig. 2c, it only took 2 h for the bacteria-free nature. As the amount of PCBs increased, more acid was cultural supernatant (15 g/L Fe3+) to leach copper from needed to neutralize the allkaline substance in PCBs. The 15 g/L PCBs. In addition, the formation rate of Fe2+ was optimum growth p H of the mixed culture was between 6. 69 g/L h. This meant that the rate of Eq. (2) was 11. 47 0. 9 and 2. 0, so the experimental conditions (p H 1-2) did times faster than that of Eq. (1). This demonstrated that not exced the optimum range of bacterial growth. The the biooxidation of Fe2+ was the rate-determining step in change of Eh is shown in Fig. 4b. Ballor et al
org/10. 1016/j. jmb. 2106. 06056. cep. 2021. 108474. Li, L. , Cai, D. , Wang, C. , Han, J. , Ren, W. ,Zheng, J. , Wang, Z. , Tan, T. , 2015. Continuus Moghadami, F. , Fooladi, J. , Hosseini, R. , 2019. Introducing a thermotolerant L-lactic acid production from defatted rice bran hydrolysate using corn Stover Gluconobacterjaponicus strain,potentiallyuseful forcoenzyme Q10production. Folia bagasse immobilized carrier. RSC Adv. 5, 18511-18517. https:/doi. org/10. 1039/ Microbiol. (Praha). 64, 471-479. https:/doi. org/10. 1007/s12223-018-0666-4. c4ra04641b. Moghadami, F. , Hosseini, R. , Fooladi, J. , Kalantari, M. , 2021. Optimization of coenzyme Li, D. , Liu, L. , Qin, Z. , Yu, S. , Zhou, J. , 2022. Combined evolutionary and metabolic q10 production by Gluconobacter jqponicus fm10 using response surface engineering improve 2-keto-L-gulonic acid production in Gluconobacter oxydans methodology. J. Appl. Biotechnol. Rep. 8, 172-179. [URL] WSH-004. Bioresour. Technol. 354, 127107. [URL] jabr. 2021. 130940. biortech. 2022. 127107. Nakamura, K. , Nagaki, K, Matsutani, M. , Adachi, O. , Kataoka, N. , Ano, Y. , Liu, L. ,Zeng, W. , Du, G. , Chen, J. , Zhou, J. , 2019. Identification of NAD-dpendent Theeragool, G. , Matsushita, K, Yakushi, T. , 2021. Relocation of dehydroquinate xylitol dehydrogenase from Gluconobacter oxydans WSH-003. ACS Omega 4, dehydratase to the periplasmic space improves dehydroshikimate production with 15074-15080. [URL] Gluconobacter oxydans strain NBRC3244. Appl. Microbiol. Biotechnol. 105, Liu, D. , Hu, Z. C. , Ke, X. , Zheng, Y. G. , 2020a. Breeding of Gluconobacter oxydans with high 5883-5894. [URL] PQQ-dependent D-sorbitol dehydrogenase for improvement of 6-(N-hydroxyethyl)- Nguyen, T. M, Goto, M. , Noda, S. , Matsutani, M. , Hodoya, Y, Kataoka, N. , Adachi, O. , amino-6-deoxy-α-L-sorbofuranose production. Biochem. Eng. J. 161, 107642. Matsushita,K. ,akushi,T. ,20a. he5Ketofructose reuctase of Gluconobacte. [URL] Strain CHM43 is a novel class in the shikimate dehydrogenase family. J. Bacteriol. Liu, D. , Ke, X. , Hu, Z. C. , Zheng, Y. G. , 2020b. Combinational expression of D-sorbitol 203 [URL] dehydrogenase and pyrroloquinoline quinone increases 6-(N-hydroxyethyl)-amino- Nguyen, T. M. , Naoki, K. , Kataoka, N. , Matsutani, M. , Ano, Y. , Adachi, O. , Matsushita, K. , 6-deoxy-α-L-sorbofuranose production by Gluconobacter oxydans through cofactor Yakushi, T. , 2021b. Characterization of a cryptic, pyrroloquinoline quinone- manipulation. Enzym. Microb. Technol. 141, 109670. [URL] dependent dehydrogenase of Gluconobacter sp. strain CHM43. Biosci. Biotechnol. enzmictec. 2020. 109670. Biochem. 85, 998-1004. [URL] 24 M. Ripoll et al. Biotechnology Advances 65 (2023) 108127 Noman, A. E. , Al-Barha, N. S. , Sharaf, A. A. M. , Al-Maqtari, Q. A. , Mohedein, A. , Enzymes and Cells. Humana Press Inc. , Totowa, NJ, pp. 333-343. [URL] Mohammed, H. H. H. , Chen, F. , 2020. A novel strain of acetic acid bacteria 10. 1007/978-1-59745-053-9_29. Gluconobacter oxydans FBFS97 involved in riboflavin production. Sci. Rep. 10, 1-17. Schmitz, A. M. , Pian, B. , Medin, S. , Reid, M. C. , Wu, M. , Gazel, E. , Barstow, B. , 2021. https:/doi. 0rg/10. 1038/s41598-020-70404-4. Generation of a Gluconobacter oxydans knockout collection for improved extraction Ordonez, J. L, Canete-Rodriguez, A. M. , Calljon, R. M. , Santos-Duenas, M. I. , Troncoso, A. of rare earth elements. Nat. Commun. 12, 1-11. https:/doi. org/10. 1038/s41467- M. , Garcia-Garcia, I. , Garcia-Parrilla, M. C. , 2017. Effect of Gluconic acid submerged 021-27047-4. fermentation of strawberry Puree on amino acids and biogenic amines profile. Schweikert, S. , Kranz, A. , Yakushi, T. , Filipchyk, A. , Polen, T, Etterich, H. , Bringer, S. , J. Food Process. Preserv. 41, e12787 https:/doi. org/10. 1111/jfpp. 12787. Bott, M. , 2021. FNR-type regulator Gox R of the obligatorily aerobic acetic acid Pal, P. , Kumar, R. , Nayak, J. , Banerje, S. , 2017. Fermentative production of gluconic bacterium Gluconobacter oxydans affects expressionof genes involved in respiration acid in membrane-integrated hybrid reactor system: analysis of process and redox metabolism. Appl. Environ. Microbiol. 87, 1-20. [URL] intensification. Chem. Eng. Process. Process Intensif. 122, 258-268. https:/doi. org/ 10. 1128/AEM. 00195-21. 10. 1016/j. cep. 2017. 10. 016. Sethuramiah, A. , Kumar, R. , 2016. Statistics and experimental design in perspective. In: Pal, P. , Kumar, R. , Banerjee, S. , 2019. Purification and concentration of gluconic acid Modeling of Chemical Wear. Elsevier, pp. 129-159. [URL] from an integrated fermentation and membrane process using response surface 0-12-804533-6. 00006-8. optimized conditions. Front. Chem. Sci. Eng. 13, 152-163. https:/doi. org/10. 1007/ Shen, Y. , Zhou, X. , Xu, Y. , 2020. Enhancement of Gluconobacter oxydans resistance to s11705-018-1721-z. lignocelulosic-derived inhibitors in Xylonic acid production by overexpressing Park, Y. M. , Choi, E. S. , Rhee, S. -K. K. , 1994. Effect of toluene-permeabilization on Thioredoxin. Appl. Biochem. Biotechnol. 191, 1072-1083. [URL] oxidation of D-sorbitol to L-sorbose by Gluconobacter suboxydans cellsimmobilized in s12010-020-03253-6. calcium alginate. Biotechnol. Lett. 16, 345-348. htps:/doi. org/10. 1007/ Shiraishi, F. , Kawakami, K. , Kono, S. , Tamura, A. , Tsuruta, S. , Kusunoki, K, 1989. BF00245048. Characterization of production of free gluconic acid by Gluconobacter suboxydans Peters, B. , Junker, A. , Brauer, K. , Mihlthaler, B. , Kostner, D. , Mientus, M. , Liebl, W. , adsorbed on ceramic honeycomb monolith. Biotechnol. Bioeng. 33, 1413-1418. Ehrenreich, A. , 2013
Mechanical Activation of Waste Phosphors 96 Five grams of the waste phosphors was mixed with se ven zirconia balls (diameter-15 mm) and fed 97 into a zirconia pot (inner volume-45 m L, inner diam eter-40 mm) for activation using a planetary 98 MANUSCRIPT ACCEPTED ACCEPTED MANUSCRIPT5 ball-mill (Fritsch P-7, Germany) under ambient atmo sphere. During activation, an interval of 15 99 minutes was set after each milling run of 15 min, t o avoid the accumulation of generated heat. 100 Activated samples were under acid leaching within 1 2 h after MA. 101 2. 3. Acid Leaching 102 Acid leaching of inactivated/activated waste phosph ors was conducted at the temperature of 60°C for 103 15 min by magnetic stirring. The liquid/solid ratio was 60 m L/g with the lixiviant volume of 40 m L. 104 The lixiviant of 6 mol/L hydrochloric acid (HCl) so lution was used for the leaching process. After 105 leaching, the liquid-solid separation was carried o ut by vacuum filtration using a cellulose acetate 106 membrane (0. 45 µm). Quantitative analysis of REEs in solution was c onducted by Inductively Coupled 107 Plasma-Atomic Emission Spectroscopy (ICP-AES: IRIS Intrepid II XSP, Thermo Fisher), and ICP-MS 108 (X Series 2, Thermo Fisher) was also used when it wa s needed. 109 3. Results and discussion 110 3. 1. REEs Leaching Enhancement and Morphology chang es of waste phosphors 111 According to Figure 1, for raw waste phosphors samples, the aver age leaching rates of Ce, La and 112 Tb were only 0. 48%, 0. 67%, and 0. 33%, respectively. However, they were significantly elevated after 113 the MA. At the range of 200-600 rpm, the average le aching rate of Tb increased rapidly from 15. 4% to 114 89. 4% with the increase of milling bowls rotational speed (from now on referred to rotational speed - 115 RS). Then, a slight enhancement of about 3. 0% was a lso achieved when the RS increased further from 116 600 rpm to 800 rpm. Similarly, the leaching rate of Ce and La increased from 15. 4% and 14. 9% at 200 117 rpm to 93. 7% and 91. 4% at 600 rpm, respectively. Th en, there was a reduction of around 2% and an 118 increase of around 5% obtained in leaching rate of Ce and La when the RS increased to 800 rpm. 119 Leaching rates of Eu and Y fluctuated at all the ra nge of RS. The average leaching rate ranged 120 MANUSCRIPT ACCEPTED ACCEPTED MANUSCRIPT6 between 81. 1% and 93. 1% for Eu, and between 84. 6% a nd 94. 6% for Y, and no significant relationship 121 could be observed between these leaching rates and RS. 122 123 Figure 1 Changes in leaching rate of REEs, as well as median diameter (D 50 ) and specific surface area 124 (SSA) of waste phosphors activated at different RS (activation time 60 min). Part of leaching rates of 125 Tb, Eu, and Y (200–800 rpm) was adapted from (Tan e t al. , 2016). 126 Activation time could also positively affect the le aching rates of REEs when waste phosphors were 127 activated at the RS of 600 rpm (Fig. 2). Leaching ra tes of all the REEs were significantly improved 128 when the activation time increased from 15 to 60 mi n. The most significant enhancement was obtained 129 for Ce, which increased from 61. 9% to 93. 7%; simila r improvement was achieved for leaching rate of 130 La and Tb as well, from 61. 5% to 91. 4%, and from 59. 8% to 89. 4%. Meanwhile, the leaching rate of 131 Eu increased from 82. 0% to 90. 4%, and for Y from 87. 9% to 94. 4%. Increasing the activation time 132 from 60 to 240 min, however, increased the leaching rates for these five REEs by no more than 3%. 133 This innovative approach showed promising leaching rates for Eu and Y, around 95%, higher than 134 those obtained under optimization conditions in stu dies using only a hydrometallurgical 135 method. (Binnemans et al. , 2013; Tan et al. , 2015; W u et al. , 2014b) These rates were also close to the 136 highest rates of 94. 6% and 99. 1% for Y and Eu, resp ectively, achieved in a study conducted by Liu et 137 al. (2014) using an alkali sintering method. Further more, an enhancement of around 10% was obtained 138 for the leaching rate of Tb in this study when comp ared with it obtained by Liu et al. (2014) and 139 conventional methods. (Wu et al. , 2014b) 140 141 Figure 2 Changes in leaching rate of REEs, as well as D 50 and SSA of waste phosphors activated in 142 different activation time (RS-600 rpm). 143 It is well known that increases in the SSA of parti cles and reduction of particle size can accelerate 144 the leaching process and improve leaching rate. How ever, according to Fig. 1 and 2, changes in SSA 145 MANUSCRIPT ACCEPTED ACCEPTED MANUSCRIPT7 and D 50 of waste phosphors showed different, even contrary , trends compared with the changes in REE 146 leaching rates when the MA conditions changed (part icle size distribution of inactivated and activated 147 waste phosphors are presented in the Supplementary Material Fig. S1 and S2). With an increase in RS, 148 the SSA of waste phosphors enlarged gradually from 0. 14 m 2/g of inactivated sample at first, then 149 suffered a rapid decrease after peaking at the RS o f 400 rpm. SSA values were 3. 31 and 1. 82 m 2/g at 150 the RS of 400 and 600 rpm, respectively, while the D 50 values were 3. 13 and 7. 20 µm, respectively. 151 Similar changes were observed when the activation t ime changed (morphology changes are presented 152 in Fig. S3). The adhesion from Van der Waals forces and chemical forces (Opoczky, 1977; Wiewióra et 153 al. , 1993) could explain the aggregation and agglom eration phenomena at high RS and long activation 154 time. Therefore, the increase in SSA and the reduct ion in particle size of waste phosphors due to the 155 MA process cannot be inferred as the main reason fo r the significant changes in REE leaching rates. 156 Chemical characteristics and crystal structures of phosphors compounds appeared to be altered via MA 157 process, what made the leaching of REEs much easier. 158 3. 2. Analysis of Physicochemical Changes in Activat ed Waste Phosphors, and Exploration of the 159 Activation Mechanism 160 According to X-ray diffraction (XRD) patterns prese nted in Fig. 3, the intensity of characteristic 161 diffraction peaks (the position can be found in Fig. S4) decreased with an increase in the activation 162 degree: specifically, increases in RS and activatio n time, and some of the peaks even disappeared 163 during the activation processes. For example, the d iffraction peak of the highest intensity in the 164 inactivated sample decreased to about 32% after act ivating for 60 min under the condition of 600 rpm 165 (detail information in Fig. S5). Meanwhile, the ful l width at half-maximum (FWHM) of peaks also 166 broadened with simultaneous increases in RS and act ivation time. These results indicate that the 167 MANUSCRIPT ACCEPTED ACCEPTED MANUSCRIPT8 crystallite size of waste phosphors compounds decre ased, the crystal structure of waste phosphors 168 compounds was destroyed and transformed to a disord ered state due to the external mechanical force 169 caused by impact, friction, and shear during activa tion(Baláž, 2008). 170 171 Figure 3 Changes of XRD patterns in waste phosphors under different activation conditions: (a) RS 172 (activation time-60 min); (b) activation time (RS-6 00 rpm). 173 Most of the phosphorus (P) in phosphors presents in the green phosphor (La PO 4: Ce, Tb), and the Ce 174 and Tb are doped in the crystal structure of La PO 4 instead of La. The La PO 4 is used for the analysis of 175 P 2p X-ray photoelectron spectroscopy (XPS) spectra because the P 2p spectra of Tb PO 4 and Ce PO 4 176 are almost overlapped by it, since the molar quanti ties of Tb and Ce are much less than La. 177 178 Figure 4 XPS spectra of inactivated and activated ( 600 rpm, 60min) waste phosphors: (a) P 2p; (b) La 179 3d; (c) Tb 3d; (d) Y 3d 180 According to Fig. 4(a), related content of La x PO y increased after MA, from approximately 20% of 181 the raw sample to 27%. The generation of La x PO y through La PO 4 decomposition was accompanied by 182 the generation of La 2O3 (Eq. 1) (Ivanova et al. , 1996). Meanwhile, the bin ding energy of P 2p showed a 183 reduction of 1
, 2008; Illmer and PVK without Mn for Fe 62±98 14±2 68±45 Schinner, 1995; Rodriguez and Fraga, 1999; Souchie et al. , 2006). AMS 166 ± 25 9±4 102± 78 Also, REE-phosphates are known to have particularly low NBRIP 8±4 5±1 5±0 solubilities in water, on the order of 10-13 M (10-i g/L) (Firsching 343 Brisson et al. : Bioleaching of Rare Earth Elements from Monazite Biotechnology and Bioengineering and Brune, 1991), whereas the solubility of Ca3(PO4)2 is (Hassanien et al. , 2013), while Shin et al. reported leaching 3. 9 × 10-6 M (0. 0012 g/L) (Haynes, 2015). effciencies of only 0. 1% for bioleaching of monazite ore (Shin et al. , With AMS medium and both versions of PVK medium, glucose was 2015). Differences in ores, bioleaching organisms, experimental completely or almost completely consumed (final concentration conditions, and measurement methodologies may have contributed ≤0. 6 g/L) (Supplementary Fig. Sla). In contrast, with NBRIP medium, to the varying results. glucose concentrations were only reduced to 6. 3 ± 0. 1, 7. 4 ± 0. 1, and Given the relatively low leaching efficiency of monazite 7. 1 ± 0. 0 g/L for A. niger, ML3-1, and WE3-F respectively. Growth on bioleaching in this study, further optimization is necessary to NBRIP medium also resulted in smaller reductions in p H than growth achieve an economically viable process. There are several potential on other media (Supplementary Fig. S2a). avenues for improving overall leaching efficiency. The results of the In the study by Nautiyal introducing NBRIP medium, several growth conditions comparisons suggest some important factors. In versions of the medium were compared with several modifications addition to lacking several trace minerals, NBRIP medium also had of Pikovskaya medium, including the yeast extract free version used the lowest concentration of (NH4)2SO4 of all media tested (0. 1 g/L), in this study (PVK) (Nautiyal, 1999). They showed significantly while AMS had the highest (0. 66 g/L), suggesting that nitrogen enhanced solubilization of Ca;(PO4)bya variety of bacterial strains concentration may be an important factor. Increasing the leaching (five Pseudomonas and three Bacillus strains) with NBRIP medium. time may also be effective. Over 6 days of bioleaching, REE However, the poor performance of NBRIP medium in this study concentrations did not appear to have entirely leveled off (Fig. 2), with fungi indicates that despite its widespread use in phosphate and a longer leaching time may increase REE yield. Other process solubilization studies, NBRIP medium is not well suited for some designs beyond leaching in a single batch should also be considered PSMs and/or solubilization of some phosphate minerals. to further increase yield. The same monazite could be leached Among the five carbon sources tested, there was no clear over- several times with fresh medium and organisms to extract more performer (Fig. 2b). For ML3-1 and WE3-F, REE solubilization REEs, or a continuous fow process could be applied in which the profiles were similar for all carbon sources tested. REE monazite is retained via settling while the leachate is continuously solubilization performance for A. niger was much more variable recovered. Other potentially important factors not considered here between replicates with the same carbon source. In contrast to the include monazite grain size, aeration, and temperature. variability in REE solubilization, p H and carbon source consumption profiles were similar for A. niger for all carbon Proportional Release of REEs and Thorium During sources tested, as they also were for the other two isolates Bioleaching (Supplementary Fig. S1b and S2b). For the glucose concentrations tested (5, 10, and 100 g/L), higher Proportions of REEs and Th in monazite and in bioleaching glucose concentrations did not correspond to improved REE supernatant are shown in Fig. 3. The monazite sand used in this solubilization for ML3-1 and WE3-F (Fig. 2c). For A. niger, the study is dominated by Ce, La, Nd, and Pr, and the bioleaching performance was again quite variable, and although the average supernatant refected this composition (Fig. 3a). Release of Th REE concentration was highest for 100 g/L glucose, this difference during bioleaching was low in proportion to REEs. For standard was not statistically significant. The p H reduction was comparable growth conditions (AMS medium, 10 g/L glucose), averages for all glucose concentrations tested (Supplementary Fig. S2c). for released Th were 0. 026±0. 046, 0. 0003±0. 0001， and Interestingly, for the lowest glucose concentration (5g/L), 0. 0028 ±0. 0039 mole Th per mole REEs for A. niger, ML3-1, the glucose was consumed by the fourth day (Supplementary and WE3-F respectively (nine replicates each). In comparison, the Fig. S1), but REE concentrations continued to rise through the end monazite contained 0. 11 ± 0. 02 mole Th per mole REEs (seven of the experiment. For the highest glucose concentration replicates),indicting preferential release of REEs over Th relative to (100 g/L), glucose levels remained above 10g/L for the entire the amounts present in the monazite ore. experiment. These data indicate that glucose availability was not the In comparison, Th release in conventional monazite processing limiting factor for bioleaching under the conditions tested. varies. In the commonly used Na OH treatment process, the majority In a 2013 study, Qu and Lian examined bioleaching of REEs from of Th is leached along with REEs and must be separated in red mud, a byproduct of bauxite ore processing for alumina downstream processing (Gupta and Krishnamurthy, 1992; Peelman production, by Penicilum tricolor RM-10 (Qu and Lian, 2013). They et al. , 2014). The Ca Cl2/Ca CO3 process leaves most Th in the reported total REE concentrations in the leachate of 20 to 60 mg/L, residual, although this process also has less favorable REE yields compared to 60 to 120 mg/L for monazite bioleaching by ML3-1 and and requires much higher temperatures (Merritt, 1990; Peelman WE3-F in this study. These concentrations corresponded to leaching et al. , 2014). Th release during the sulfuric acid process depends on efficiencies of 20%-40%, compared to 3%-5% found in this study. the specific leaching conditions (Gupta and Krishnamurthy, 1992; Note that the red mud efficiency numbers are higher even though the Peelman et al. , 2014). overall concentrations are lower due to the lower starting concentrations of REEs in the red mud. Given the differences in Organic Acid Production During Bioleaching the ores (red mud vs. monazite) and experimental time scales (50 days vs. 6 days), it is not surprising that leaching efficiencies differ. Organic acid production was observed for all organisms, with each Two recent studies addressing monazite bioleaching reported organism producing a different set of acids. For a given organism, widely ranging leaching effciencies. Hassanien et al. reported organic acid production was variable, and not all acids were efficiencies of up to 75% for bioleaching of monazite concentrate detected in all biological replicates. Table III lists the maximum 344 Biotechnology and Bioenginering, Vol. 113, No. 2, February, 2016 production of higher concentrations of oxalic acid corresponded with lower concentrations of REEs, which is consistent with the Proportion of REEs and Th in Monazite known low solubility of REE-oxalates (Gadd, 1999). and in Bioleaching Supernatant ML3-1 produced primarily itaconic and succinic acids and WE3- other REEs F produced acetic, gluconic, and succinic acids. As noted above, Pr La Th ML3-1 showed high sequence similarity to A. terreus, some strains of which have been used industrially to produce itaconic acid (Magnuson and Lasure, 2004). A. niger and WE3-F also produced some compounds that generated large peaks in the HPLC UV 0. 1 absorbance chromatogram, but could not be identified based on the availablestandards. Other PSMstudieshave alsoobserved 3三E additional compounds presumed to be other organic acids Y potentially involved in phosphate solubilizing activity (Chen 40 uo. et al. , 2006). Abiotic Leaching With Hydrochloric Acid and Organic Acids For all abiotic leaching experiments, leaching was performed for 48 h. Preliminary experiments indicated that this was sufficient 0. 0 time to reach equilibrium REE concentrations. Leaching with inorganic HCl solutions representing a range of 105 acidities (p H 1. 8-3. 7) indicated an approximately linear (r² = 0. 96) A A a. b. inverse correlation between p H (final p H after leaching) and REE Figure 3
Hence, mining has traditionally useful for identifying significant differences in state-of-the-art been realized by self-organizing individual companies in the approaches when it comes to different types of such mineral private sector. Analogously, extraction of metals situated in tech- recovery. Applying the taxonomy in future research will thus nospheric stocks may become increasingly profitable. Hence, facilitate identification and comparison of similar studies dealing technospheric mining could be driven bottom-up by mining with mineral recovery from technospheric stocks - a fundamental companies that perceive technospheric stocks as a valuable need for building a common knowledge base and thus a more resource. For example, development of technology could make stringent and progressive research field. previously unattractive concentrations and accessibilities inter- This taxonomy could also be seen as a way to distinguish tech- esting, similar to the technology push in traditional mining and the nospheric mining initiatives from traditional mining as well as case of deep sea mining (Halfar and Fujita, 2002). New business waste management and recycling concepts. Doing so is essential as models could also be adopted in which income and expenses are this type of mineral recovery, apart from traditional drivers and shared, for example, between the owner, collector, and recycler barriers for improved waste management, also is related to addi- (Baas et al. , 2010). Other resources obtained from the excavation tional challenges, originating from the fact that the minerals may also add income such as combustibles in a landfill or selling the occurring in technospheric stocks involve different characteristics rehabilitated land. Projects could also be evaluated through the in terms of size, metal concentration, location, accessibility and societal costs of the consequences of not conducting mining level of disparity. Being absolutely clear about such differences in activity, for example, the cost of not extracting a landfill (van Passel future research seems fundamental. Otherwise, there is an obvious et al. , 2o10) or collecting marine debris. A future where fishing risk that we will fail to even identify the unique technical, boats collect marine debris profitably, instead of over fishing the economic, organizational and legislative challenges facing this sea, is an appealing scenario. This has been tested by societies emerging field of technospheric mining. realizing the actual cost of uncontrolled marine debris, specifically in South Korea based on governmental funding (Cho, 2009). Acknowledgements Technospheric mining initiatives are currently often driven by environmental reasons, or in other words primarily executed to Financial support was provided by the Swedish Innovation "save" the environment. Relative concentrations of metals within Agency, VINNOVA and the Swedish Research Council for Environ- the technosphere, if situated in the wrong surroundings such as ment, Agricultural Sciences and Spatial Planning, FORMAS. near ground water, may be an alarming problem. To prevent this problem, landfills, slag heaps, and tailing ponds can be mined. Such References an approach, with roots in the perception of technospheric stocks as a problem, would probably be driven top-down by environ- Allen, D. T. , Behmanesh, N. , 1994. Wastes as raw materials. In: Allenby, D. T. mental or health regulation, forcing ownership of and responsi- Richards, D. J. (Eds. ), The Greening of Industrial Ecosystems. National Academy Press, Washington, DC, pp. 6989. bility for metal stocks. At a first level of an analysis, it is reasonable 8 In 1994, for example, 2. 6 Tg of copper was recycled globally, corresponding to. 7 A study of insurance databases by Whiteacre and Howes (2o09) showed that. 15% of the global production of copper (Graedel et al. , 2004). Detroit for example had 271 metal theft claims per 100,o00 residents. N. Johansson et al. / Journal of Cleaner Production 55 (2013) 35-44 43 Ayres, R. , 1999. The second law, the fourth law, recycling, and limits to growth. in the Dutch economic system. Resources, Conservation and Recycling 42, Ecological Economics 29,473-484. 133-154. Ayres, R. , Holmberg, U. J. , Anderson, B. , 2o01. Materials and the global environment: Engstrom, F. (201o) Mineralogical influence on leaching behaviour of steelmaking slags a laboratory investigation. Ph D Dissertation, Luleas Tekniska Hogskola. waste mining in the 21st century. MRs Bulletin 26, 477-480. Baas, L. , Krook, J. , Eklund, M. , Svensson, N. , 2010. Industrial ecology looks at landfills U. S. Environmental Protection Agency. Online: [URL] from another perspective. Regional Development Dialogue 31 (2), 169-183. Benn, F. W. , Cornell, W. L. , 1993. Removal of heavy metals from Missouri lead mill 14369. pdf. access 31. 10. 11. tailings by Froth Flotation. Separation Science and Technology 28 (1-3), EPA, 1993b. Slag Reprocessing: Magma Copper Company's San Manuel Facility. U. S 733-746. Environmental Protection Agency. Online: [URL] Bergback, B. , Johansson, K. , Mohlander, U. , 2o01. Urban metal flows - A case study 17052. pdf (access 31. 10. 11. ). European Council, 1991. Council Directive 75/442/EEC modified by Directive 91/156/ of Stockholm. Water, Air and Soil Pollution 1, 3-24. Bertram, M. , Graedel, T. E. , Rechberger, H. , Spatari, S. , 2o02. The contemporary EEC on waste. European Council, 1999. Council Directive 1999/31/EC of 26 April 1999 on the European copper cycle: waste management subsystem. Ecological Economics Landfill of waste. 42,43-57. Eurostat, 2o09. Waste Generated and Treated in Europe. Office for Official Publi- Bialucha, R. , Merkel, T. , Motz, H. , 2o11. European Environmental Policy and Its cations of the European Communities, Luxembourg. Influence on the Use of Slag Products. In: Jones, P. T. , Pontikes, Y. , Elsen, J. , et al. Franke, M. , Mocker, M. , Faulstich, M. , 2010. Resource Potential of Landfill Mining A (Eds. ), Proceedings of the Second International Slag Valorisation Symposium:. The transition to Sustainable Materials Management. online: [URL] National and Regional Evaluation. ISw A World Congress. 15th-18th November valorisation-symposium. eu/images/papers/s3_3_motz. pdf (access: 10. 11. 11. ). 2010 Online: [URL] Boliden, 2008. Sustainability Report 2007. Boliden AB, Sweden. (access 31. 10. 11. ). Frosch, R. A. , Gallopoulos, N. E. , 1989. Strategies for manufacturing. Scientific Bonnal, C. , Alby, F. , 2ooo. Measures to reduce the growth or decrease the space debris population. Acta Astronautica 47 (2-9), 699706. American 261 (3), 144-152. Frandegard, P. , Krook, J. , Svensson, N. , Eklund, M. , 2013. A novel approach for Bradley, A. M. , Wein, L. M. , 2o09. Space debris: assessing risk and Responsibility. Advances in Space Research 43, 1372-1390. environmental evaluation of landfill mining. Journal of Cleaner Production 55, Brocchi, E. A. , Moura, F. J. , 2o07. Chlorination methods applied to recover refractory 24-34. Gerst, M. D. , Graedel, T. E. , 2oos. In-use stocks of metals: status and implications. metals from tin slags. Minerals Engineering 21 (2), 150-156. Environmental Science and Technology 42, 7038-7045. Brunner, P. H. , Rechberger, H. , 2o04. Practical Handbook of Material Flow Analysis. Lewis Publishers, Boca Raton. Ghasemi, E. , Shahriar, K. , Sharifzadeh, M. , 2010. A new method for risk assessment Brunner, P. H. , 2o07. Reshaping urban metabolism. Journal of Industrial Ecology 11 of pillar recovery operation. Safety Science 48 (10), 1304-1312. Gorai, B. , Jana, R. K. , Premchand, 2o02. Characteristics and utilisation of copper. 2),11-13. Bugnosen, E. , 2o01. Country Case Study on Artisanal and Small-scale Mining: slag-a review. Resources, Conservation and Recycling 39 (4), 299-313. Philippines. MMs D. Online: [URL] (access: Gordon, R. B. , 2002. Production residues in copper technological cycles. Resources, 31. 10. 11. ). Conservation and Recycling 36,87-106 Chan, M. (2o04) Hibernating Copper in Connecticut Residences and Corporations. Graedel, T. E. , van Beers, D. , Bertram, M. , Fuse, K
The usage of sulfur substrate also caused pulp density (Ye et al. , 2017). For example, in contact bioleaching Acidithiobacillus and Sulfuritalea to dominate the microbial at elevated pulp densities, microbial leaching performance is community composition, further enhancing the leaching inhibited by releasing toxic compounds and insufficient agitation efficiency (Wu C. et al. , 2020). However, a high dose of sulfur (Meshram et al. , 2016; Marra et al. , 2018). Pulp density affects p H, inhibits the substrate in the bioleaching process. Furthermore, inhibiting microbial growth and reducing the metal extraction unused or unoxidized sulfur may cause re-acidification of treated rate. The use of bioleaching on a large scale is significantly soils during the bioleaching process. As a result, the sulfur dose influenced by pulp density (Liu et al. , 2020). A 2% pulp density utilized in bioleaching must be carefully calculated instead of 1% accounts for a 50% reduction in the quantity of bioleaching solution required, lowering the operating cost (Niu Surfactants and natural extracts et al. , 2014). In a batch reactor, the impact of varied mineral pulp densities of 5, 10, and 30 g/L on bacterial activity was studied. The p H of A. thiooxidans increased as the pulp density increased, but The eco-sustainability, superior contaminant removal efficiency,. the p H of P. putida did not alter as the pulp density increased. flexibility, and the green chemistry basis of surfactants have gained. (Bolanos-Benitez et al. , 2018). High pulp density is expected to them attention for removing contaminants from their different. restrict microbial activity, hence a pulp density of 15% had a. media (Rasheed et al. , 2020; Kumar et al. , 2022). The surfactant's Frontiers in Microbiology 15 frontiersin. org 10. 3389/fmicb. 2022. 1049277 Sarkodie et al. unusual molecular structure improves the water solubility of soil complicated role of microorganisms. These techniques will help pollutants, particularly hydrophobic organic molecules (He et al. predict the metabolic models and improve scientific understanding of the physiology of the microorganisms used in bioleaching 2016). This may be attributed to the decrease in surface tension and reduction of mass transfer of oxygen hence surfactants can speed (Watling, 2016). Additionally, these omics technologies will aid in up and enhance the rate of leaching (Aioub et al. , 2019). As the discovering novel features and characteristics of microorganisms relating to gene, protein, macromolecule, and environmental bioleaching system relies on the multi-phase interface interactions interactions (Baniasadi et al. , 20i9). Genomics is currently between microbes, minerals, solution, and other factors, altering the properties of mineral surfaces and bacterial outer membranes enhancing our understanding of bioleaching. Through partial and whole-genome sequencing, it has become possible to identify enhances the interface action between microbes and minerals to. biodiversity within leaching environments and create molecular- increase leaching speed (Fang et al. , 2014). Different surfactants, based methods for analyzing the temporal dynamics of various including anionic, cationic, zwitterionic, and nonionic, have been tested and/or applied to remove toxic metal(loid)s from bioleaching processes. For a while, it was thought that contaminated soils. Generally, surfactant adsorption into soils is. Acidithiobacillus ferrooxidans was the most important bacteria for supposed to be minimal for successful surfactant-enhanced metal sulfide bioleaching; however, current development in remediation, however, surfactants have a considerable solubilizing genomics comprising bioidentification molecular techniques such activity on the target pollutant and can also be harmful to the as DGGE, FISH, and quantitative PCR (q PCR), has prompted the microbial community (Mao et al. , 2015; Kumar et al. , 2021). This search for novel species with potential in extreme mineral leaching contributes to toxic metal(loid)s being removed via the surfactant environments. The identification of heterotrophic archaea initially associated complexation and ion exchange. Besides the positive classified as Ferroplasma cupricumulans and later reclassified as Acidiplasma cupricumulans, the moderate thermophilic mix and/or effect of solubilizing and desorbing soil contaminants, biosurfactants promote microbial decomposition of the contaminants, hence heterotrophs from the genus Sulfobacillus, and the acilitating the removal mechanism. Combining surfactants with chemolithoautotrophic iron-oxidizing Leptospirilli are iust a few facilitating the removal mechanism. Combining surfactants with chemolithoautotrophic iron-oxidizing Leptospirilli are just a few other additives, such as organic solvents, chelating agents, and examples of how genomics has been used to show the diversity of ligand ions can also enhance the removal of contaminants from the microbial populations in bioleaching operations. A high-throughput proteomic study identified 131 proteins in the periplasmic fraction soil (Zheng et al. , 2012). of thiosulfate-grown cells, which has contributed to a better understanding of Acidithiobacillus ferrooxidans ATCC 23270 sulfur Limitation of the bioleaching. oxidation metabolism (Chi et al. , 2007). Moreover, at present, technology targeted and untargeted analytical strategies for analysis and detection of metabolites, using capillary electrophoresis and MS for The public's health, the environment, and the economy are all separation and identification, have been used in the first greatly improved by bioleaching technology. This has contributed metabolomic study in bacteria using two microorganisms isolated to it gaining much attention since it is simple to operate, less from mining sites in Chile, Acidithiobacillus ferrooxidans strain Wenelen, DSM 16786 and Acidithiobacillus thiooxidans strain expensive, lower energy requirement and less toxicity. However, the process constrained with certain limitations. This includes the Licanantay, DSM 16786 (Martinez et al. , 2013). slow kinetics of the bacterial leaching process. Therefore, it is One of the essential aspects of bioleaching is biofilm important develop catalyst to optimize the interactions of the formation. Biofilm cells are immersed in an EPS matrix that aids microbes with the minerals while accelerating the kinetics. Also, in the adhesion of biofilm cells to solid surfaces and the subsequent most studies in respect to bioleaching of contaminated soil is corrosion of those surfaces (Vera et al. , 2013). This corroborates limited to laboratory scale and hence accurate estimation for with the high spermidine concentrations, especially under sulfur growth conditions, observed in the supernatants of commercial scale is still in the infancy stage. Furthermore, toxic chemicals are sometimes produced in the process. For example, Acidithiobacillus ferrooxidans strain Wenelen and Acidithiobacillus sulfuric acid and H+ ions generated can seep into the ground and thiooxidans strain Licanantay (Martinez et al. , 2013). In summary, surface water, rendering it acidic and harming the ecosystem. For bioleaching has experienced some success with genomics, proteomics, and metabolomics, although there are still significant these reasons, a bioleaching setup must be carefully planned to gaps in the literature. Due to the sensitivity and imprecision of prevent the process from compromising biosafety. current methods like mass spectrometry, many proteins are still unable to be identified using proteomics. To address this issue, Current and future perspectives of. efforts are being made to replace mass spectrometry with other omics on bioleaching. technologies, such as sub-nanopore array, nanopore 5D On bi Ot Ca Cnmmg fingerprinting, and fluorescent protein fingerprinting. In the study. Genetics, genomics, metabolomics, and proteomics are novel of bioleaching, metabolomics is still in its infancy, and no one. technology platforms referred to as omics. The use of an omics. analytical technique has adequately accounted for all the metabolic. components of environmental materials. Therefore, more approach in bioleaching will assist in answering concerns about the. Frontiers in Microbiology frontiersin. org 16 10. 3389/fmicb. 2022. 1049277 Sarkodie et al. Funding sophisticated methods are required to detect every bioleaching microorganism metabolite. Financial support from the National Key Research and Development Program of China (Grant No. 2018YFC1800400), Conclusion the National Natural Science Foundation of China (Grant No. 51909282), Natural Science Foundation of Hunan Province of China (Grant No. 2022JJ40583) and Hunan Provincial Key. The accumulation of toxic metal(loid)s in soil, their long-term. persistence, and eventual penetration into the food chain can cause Research and Development Plan (Grant No. 2022WK2017) is highly appreciated. significant environmental damage. In the last decade, bioleaching has become a promising technology for removing toxic metals (loids) from contaminated soil and has received much attention due to its Conflict of interest economic value and eco-environmental friendliness. Although not. much literature has been reported on the use of bioleaching for contaminated soils on a large scale, advancement in the process will The authors declare that the research was conducted in the absence of any commercial or financial relationships that could. enable its use on a larger scale. Additionally, the environmental remediation value of bioleaching will be enhanced if the bioleaching be construed as a potential conflict of interest. process is used in conjunction with omics, as this will assist in. developing novel strains that are applicable for use in large-scale. Publisher's note. bioleaching of contaminated soil
[47] B. Kronholm,C. G. Anderson,P. R. A. Taylor, JOM2013,65,1321. [48] J. Florek,A. Mushtaq,D. Larivière,G. Cantin,F. -G. Fontaine,F. Kleitz, RSCAdv. 2015,5,103782. [49] H. M. Marwani, H. M. Albishri, T. A. Jalal, E. M. Soliman, J. Chem. 2017,10,S1032. [50] C. E. Slutter,D. Sanders,P. Wittung,B. G. Malmström,R. Aasa,J. H. Richards,H. B. Gray,J. A. Fee, Biochemistry 1996,35,3387. Adv. Mater. 2025,37,2412607 2412607(8of8) ©2025The Author(s). Advanced Materialspublishedby Wiley-VCHGmb H 15214095, 2025, 10, Downloaded from [URL] Wiley Online Library on [22/07/2025]. See the Terms and Conditions ([URL] on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Over 200 reference strains of various species were included. Asidefrom the few species for which only the type strain has been analyzed, uniform and distinct patterns were observed for many species of fluorescent and nonfluorescent organisms (P. aeruginosa, P. agarici, P. alcaligenes, P. amygdali, P. caricapa- payae, P. chlororaphis, P. chichorii ,“P. coronafaciens ”,P. corrugata, P. ficuserectae, P. fragi, P. mendocina, P. pertucinogena, P. tolaasii , and P. viridiflava ). In contrast, P. fluorescens, P. marginalis, P. pseudoalcaligenes, P. putida, P. stanieri ,a n d P. stutzeri were found to be particularly heterogeneous, in confirmation with earlier data on their phenotypic characteristics. Ribosomal proteins. These proteins, similarly to the ribonucleic acids with which they are associated in the ribosome, are of a highly con- servative nature. Obviously, this should be reflected in a comparison of their sequences. In fact, partial amino acidsequences of preparations of protein L30 from species of various ribosomal RNA similarity groups give clusters similar to those that had originally been defined in r RNA–DNA hybridization studies (Ochi, 1995). Despite different levels of conservatism, other ribosomal proteins (S20, S21, L27, L20, L31, L32, and L33 protein families) give comparable results. Other membrane proteins. The discussion on this point will be limited to the identifi- cation of lipoprotein I in species of Pseudomonas. W o r kp e r - formed on the specificity of the P. aeruginosa lipoprotein I gene used as a probe for rapid identification purposes was an extension of the experiments of Saint-Onge et al. (1992). The work included more strains of species of RNA group I ( Pseu- domonas ), as well as the related “ Azotomonas ”a n d Azomonas species and other species of Gram-negative organisms. All of. This article is © 2005 Bergey’s Manual Trust. Published by John Wiley & Sons, Inc. , in association with Bergey’s Manual Trust. Bergey’s Manual of Systematics of Archaea and Bacteria 41 the species of Pseudomonas t h a tw e r et e s t e dg a v ep o s i t i v er e a c - tions of variable intensities in PCR and dot blot tests using monoclonal antibodies for the lipoprotein I, whereas species of other similarity groups and of other Gram-negative generagave negative reactions. These data, still considered to be ofa preliminary nature, suggest that P. aeruginosa can be differ- entiated from the other species of the same genus that have been tested, with the exception of P. mendocina, P. pseudoalcali- genes ,a n d P. oleovorans , which have similar restriction patterns in their lipoprotein I gene (De Vos et al. , 1993). Fatty acid analysis. Fatty acid composition and the quinone system have been used for groupings of Pseudomonas species (Ikemoto et al. , 1978; Yamada et al. , 1982; Oyaizu and Komagata, 1983). A study of the fatty acid composition of 50 strains of var-ious Pseudomonas species revealed the presence of the straight-chain saturated acid of C 16:0and straight-chain unsat- urated acids C16:1and C18:1in all strains (Ikemoto et al. , 1978). Distribution of hydroxy acids, cyclopropane acids,and branched-chain acids follows quite closely the acceptedsubdivision of the aerobic pseudomonads into RNA similar- ity groups. These cellular components are very useful for identification purposes. The results of fatty acid and quinones analyses, performed on a collection of 75 strains that included phytopathogenic pseudomonads, have been reported (Oyaizu and Komagata, 1983). The survey gave a basis for the classification of the col-lection into groups with particular reference to the presenceof 3-OH fatty acids, and some of the groups coincided withthe RNA similarity groups already defined (Palleroni et al. , 1973). The analysis of a large number of fatty acid profiles obtained from a collection of 340 strains of pseudomonadsthat includes plant pathogenic species has been published (Stead, 1992). The results on the distribution of 2-OH and 3-OH fatty acids could serve as one of the bases for a subdivi-sion of the collection into six groups warranting independentgeneric designations. The above comments on fatty acid composition studies refer to Pseudomonas sensu lato and coincide in supporting the division of these organisms into the various genera thatlater were to be proposed in various communications fromdifferent laboratories. A summary of the results of the above sources is presented in Table 3. In a more recent communication (Vancanneyt et al. , 1996b) the fatty acid composition of whole-cell hydrolysates TABLE 3. Fatty acid and ubiquinone composition of Pseudomonas and other r RNA similarity groups a Compound Ribosomal RNA similarity groups I II III IV V Fatty acids : C10:0 3OH+ + + C11:0 3OH+ C11:0 iso 3OH+ C12:0 3OH+ ++ C12:0 iso 3OH+ C13:0 iso 3OH+ C14:0 3OH+ + C16:1 3OH+ C12:0 2OH(+) C16:0 2OH(+) C16:1 2OH(+) C18-1 2OH+ Ubiquinones Q-9 Q-8 Q-8 Q-10 Q-8 a Data taken from Oyaizu and Komagata (1983) and Stead (1992). Data in parentheses: not allstrains of the group are positive. and phospholipid fractions are reported. The results con- firm some of the conclusions of the above-cited references. In general, Pseudomonas species are characterized by the presence of C 10:0 3OH and C12:0 3OH acids. When the fatty acid contents of phospholipids were taken into account, no clear separation could be found between Pseudomonas RNA group I organisms and RNA similarity groups II and III. Polyamine composition. Polyamine patterns appear to be good chemotaxonomic markers for the Gram-negative bacteria in the phylum Pro- teobacteria , allowing ready differentiation of some of the pseudomonad groups (Busse and Auling, 1988). In addi- tion to quinone analysis, polyamines are useful for rapid identification at the genus level (Busse et al. , 1989). Thislast contribution includes a discussion of various otherapproaches applicable to species and strain identification. In an attempt to relieve the dearth of simple and reliable tests for the classification of newly isolated strains of the genus Xanthomonas , a determination of polyamine composition of strains of this genus and of phytopathogenic Pseudomonas species was introduced as a rapid chemotaxonomic identifi- cation tool (Auling et al. , 1991). Spermidine was found tobe the main polyamine of Xanthomonas , whereas strains of. This article is © 2005 Bergey’s Manual Trust. Published by John Wiley & Sons, Inc. , in association with Bergey’s Manual Trust. 42 Bergey’s Manual of Systematics of Archaea and Bacteria Pseudomonas RNA group I were characterized by the presence of putrescine. The polyamine pattern of Azotobacter and Azomonas was the same as that of the fluorescent pseudomon- ads, which are placed in the same branch of Proteobacteria. The results obtained by Auling et al. (1991) were confirmedin a more recent study by Goris et al. (1998). Aside from thepresence of putrescine and spermidine mentioned above, thespecies of Pseudomonas could be divided into two sub-lineages, of which only one contained cadaverine. P. aeruginosa (as well as Azotobacter vinelandii ) is in the sublineage that contains this polyamine. List of species of the genus Pseudomonas The following list includes those species whose assignment to the genus Pseudomonas has been definitely established. Part of the information for some of the species has been condensedin the form of tables representing updated versions of thoseof the first edition of this Manual. The order is alphabetical, thus avoiding the problem of ordering the species on the basis of properties suchas pathogenicity, pigmentation, or certain physiologicalpeculiarities, which only seldom correlate with the order ofgroups based on 16S r RNA sequence similarities (Figures 4and 5). Pseudomonas can be subdivided into two big groups, the fluorescent and the nonfluorescent species and, withrespect to plant pathogenicity, a subdivision of the genus intosaprophytes and plant pathogenic species is possible. Thesesubdivisions do not correlate with each other. Some correla-tions, however, are apparent. In Figure 4 the plant pathogenscongregate mostly in the so-called P. syringae group. The members of some pairs of species ( P. migulae – P. mandelii ;P. veronii–P. gessardii ;P. cedrella–P. orientalis ;P. marginalis–P. libanensis ;P. fuscovaginae–P. asplenii ,a n d P. monteilii –“P. ayucida ”) were found to have identical 16S r RNA sequences (see Figure 4) (Anzai et al
ST was supported by project Ribes Network Kingdom4choolf Biscienceniversitf Kent,Canterbury,ent,d POR-FESR 3S4H (No. TOPP-ALFREVE18-01) and PRID/SID of University of Kingdom. 41 University of Missouri, Computer Science, Columbia, Missouri, Padova (No. TOPP-SID19-01). CZ and ZW were supported by the NIGMS grant USA. 42Department of Electrical Engineering and Computer Science, University Consortium Genome Biology (2019) 20:244 Page 21 of 23 of Missouri, Columbia, MO,USA. 43University of Miami, Coral Gables, Florida, Algorithms, Fudan University, Shanghai, China. 104Key Laboratory of USA. 44Centre for Systems and Synthetic Biology, Department of Computer Computational Neuroscience and Brain-lnspired Intelligence (Fudan Science, Royal Holloway, University of London, Egham, Surrey, United University), Ministry of Education, Shanghai, China. a. 105State Key Laboratory of Kingdom. 45 school of Mathematics, Statistics and Applied Mathematics, Genetic Engineering and Collaborative Innovation Center for Genetics and National University of lreland, Galway, Galway, Ireland. 46Technical University Development, Department of Biostatistics and Computational Biology, School of Munich, Garching, Germany. 47Faculty for Informatics, Garching, Germany. of Life Sciences, Fudan University, Shanghai Shanghai, China. 106Department 48Department for Bioinformatics and Computational Biology, Garching, of Pediatrics, Brain Tumor Center, Division of Experimental Hematology and Germany. 49school of Computing Sciences and Computer Engineering, Cancer Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH, Hattiesburg,Mississippi,UA. 5nstituteof Biotechology,elsinki Institutf USA. 107 Pacific Lutheran University, Department of Computer Science, Tacoma, if WA,USAepatment f Cmuterienceatinalhengchiiversit Biotechnlgy Univrsity of Helsink,Helsinki inland. ompugen Taipei, Taiwan. iogokinawa Institute of Science and Technology, Tancha, Holon, lsrael 53Baylor College of Medicine,Department of Biochemistry and Okinawa Molecular Biology, Houston, TX, USA. 54Baylor College of Medicine, and Mathematical Sciences & Engineering Division, Computational Bioscience Department of Molecular and Human Genetics, Houston, TX, USA. 5National Research Center, King Abdullah University of Science and Technology, Thuwal, Tsing Hua University, Hsinchu, Taiwan. 56Department of Electrical Engineering Jeddah, Saudi Arabia. 112Computational Bioscience Research Center (CBRC), in National Tsing Hua University, Hsinchu City, Taiwan. 57The Hebrew King Abdullah University of Science and Technology, Thuwal, Saudi Arabia. University of Jerusalem, Jerusalem, Israel. 58niversity of California San Diego, 113Computer,Eectricaland Mathematical Sciencesnginering Divisn San Diego Supercomputer Center, La Jolla, California, USA. 59Department of (CEMSE), King Abdullah University of Science and Technology, Thuwal, Saudi Computational Biology and Center for Integrative Genomics, University of Arabia. 114politecnico di Torino, Control and Computer Engineering Lausanne, Lausanne, Switzerland. 60Department of Genetics, Evolution & Department, Torino, TO, Italy. 115University of Turku, Department of Future Environment, and Department of Computer Science, University College Techlgrurnaiitf London, London, UK. 61 swiss Institute of Bioinformatics, Lausanne, Graduate School (UTUGS), Turku, Finland. 117University of Turku, Turku, Finland Trnfmuciera Lja 119Deparment f Futreeclogie Facultf Scincend Enginering International Postgraduate School, Ljubljana, Slovenia. 65Research Department Univeritf Tr00rlanf of Structural and Molecular Biology, University College London, London, Science (TUCS),Agora, Vesilnnantie 3, FI-20500, Turku, Finland. 121University f England. 6Research Department of Structural and Molecular Biology, Turku, Department of Future Technologies, Turku, Finland. 122Department of University College London, London, United Kingdom. 67 Oxford Brookes Biological Sciences, Department of Computer Science, Purdue University, West University, Department of Health and Life Sciences, London, UK. 68University Lafayet,,ant Pdiativeritf Ct College London, Department of Computer Science, London, United Kingdom. Cincinnati 45229, OH, USA. 124Department of Computer Science, Purdue 69The Francis Crick Institute, Biomedical Data Science Laboratory, London, University, West Lafayette, IN, USA. 125Division of Eectronics, Rudjer Boskovic United Kingdom. epartment of Genetics,Eolution and Environment, Institutatifc University College London, Gower Street, London WC1E 6BT, United Kingdom. Zurich, Switzerland. 127s IB Swiss Institute of Bioinformatics, Zurich, Switzerland. 7SIB Swiss Institute of Bioinformatics, 1015 Lausanne, Switzerland. 12Depaenf Cmutcincelrad Statierstyrli 72Cardiovascular Proteomics Laboratory, Centro Nacional de Investigaciones CO,USA. 129Department of Informatics,Bioinformatics&Computational Cardiovasculares Carlos Ill (CNIC), Madrid, Spain. 73Spanish National Cancer Biologhisirsithiat Research Centre (CNIO), Madrid, Spain. 74Universita degli Studi di Milano - for Food and Plant Sciences WZW, Technische Universität Munchen, Freising, Computer Science Deartment -Anacleto Lab, Milan, Milan, Italy. 7Institut Gemasit Biologie Computationnelle, LIRMM, CNRS-UMR 5506, Universite de Universityfllinisathicago,hicago,llinos UAi3Geiselch Montpellier, Montpellier, France. 76Department of Informatics, Bioinformatics Medicine at Dartmouth, Department of Molecular and Systems Biology. and Computational Biology—i12, Technische Universitat Munchen, Munich, Hanover, NH, USA. 134Department of Systems Pharmacology and Translational Germany. 77University of Lorraine, CNRS,Inria, LORIA, 54000 Nancy, France. Therapeutics, Perelman School of Medicine, University of Pennsylvania, 78University of Lorraine, Nancy, Lorraine, France. 79Inria, Nancy, France. epanilgriestr Lemonade Stand Foundation, Philadelphia, Pennsylvania, USA. 136 Khoury Center for Data Science, New York,NY 10010, USA. 82Flatiron Institute, CB, College of Computer Sciences, Northeastern University, oston, MA, USA. 10010 New York, NY, USA. 83Center for Computational Biology (CCB),Flatiron Institute, Simons Foundation, New York, New York, USA. 84Center for Data Received: 16 May 2019 Accepted: 24 September 2019 Published online: 19 November 2019 Human Genetics, University of Oxford, Oxford, UK. 86 Department of Molecular Medicine, University of Padova,Padova, Italy. 87Department of Biology - University of Padova, Padova, Italy. 88CNR Institute of Neuroscience, Padova, References Goodwin S, Mc Pherson JD, Mc Combie WR. Coming of age: ten years of Italy. 89Department of Biomedical Sciences, University of Padua, Padova, taly. next-generation sequencing technologies. Nat Rev Genet. 2016;17(6): 90Department of Computer Science, National University of Computer and Emerging ciece Peshawarhyber Paktonkhwaakistan Dpamt 333-51. Aebersold R, Mann M. Mass spectrometry-based proteomics. Nature. of Computer and Information Sciences, Temple University, Philadelphia, PA, 2003;422(6928):198-207. USA. 92University of California, Riverside, Philadelphia, PA, USA. 93Department 3. Schnoes AM, Ream DC, Thorman AW, Babbitt PC, Friedberg I. Biases in of Biology, Brigham Young University,Provo, UT, USA. 94Bioinformatics Researchrou Prv Achoolf Bilgicacnenierit the experimental annotations of protein function and their effect on our understanding of protein function space. PLo S Comput Biol. 2013;9(5): Reading, Reading, England, United Kingdom. 96Department of Pharmaceutical Chemistry, San Francisco, CA, USA. 97UC Berkeley - UCSF Graduate Program in 1003063. 4. Rost B, Liu J, Nair R, Wrzeszczynski KO, Ofran Y. Automatic prediction of Bioengineering, University of California, San Francisco 94158, CA, USA. 98Departmentf Bioenginring and Theraeuticiences,Universitf protein function. Cell Mol Life Sci. 2003;60(12):2637-50. 5. Friedberg l. Automated protein function prediction-the genomic California, San Francisco 94158, CA, USA. 99Research and Innovation Center, Edmund Mada Midiala challenge. Brief Bioinform. 2006;7(3):225-42. Sharan R, Ulitsky l, Shamir R. Network-based prediction of protein Laboratory of Genetic Engineering and Collaborative Innovation Center for function. Mol Syst Biol. 2007;3:88. Genetics and Development, Fudan University, Shanghai, Shanghai, China
Alkali metal hydroxides transformed these double salts to Ce (OH)4, and NH 3solution caused the same reaction but to a lesser extent. Auxiliary Information Method /Apparatus /Procedure: The authors used chemical analysis of the saturated solutions at isothermal conditions. Small amounts of Ce F 4were introduced into solutions of KF of various concentrations. The mixtures were equilibrated in para ffined flasks and periodically shaken for 6 months at the selected temperature. Samples of the liquid and solid phases, separated by filtration, were analyzed for Ce4+ and K+content after transforming the fluorides into sulfates with H 2SO4treat- ment. Ce4+was determined by a photocolorimetric method. A parallel sample was taken for K+analysis. It was also treated with H 2SO4in a Pt crucible until SO 3vapors were emitted. Then it was ignited to form K 2SO4and Ce O 2. Content of potassium was determined gravimetrically as the di fference of masses of (K 2SO4+Ce O 2) and Ce O 2(calculated from the separate analysis). Water content was found by di fference. Composition of the solid phases was confirmed by the graphical method of Schreinemakers. X-ray di ffraction of powders of the double salts and their thermal analyses were performed. Source and Purity of Materials: Ce2(CO 3)3(analytically pure) was dissolved in distilled HNO 3in the presence of H 2O2. Excess H 2O2was removed by heating. Ce (OH)3was precipitated with KOH (chemically pure) and washed with hot water until no NO 3−ions were present. The precipitate was oxidized with gaseous chlorine in alkaline medium. Ce (OH)4formed in this way was washed of Cl−, centrifuged, dissolved in HNO 3, and twice precipitated with NH 3. When traces of NH+ 4and NO− 3ions were removed by washing from the precipitate and the solution, Ce F 4was precipitated with 20 mass% HF. This precipitate was centrifuged, washed with 2 mass% HF, then with ethyl alcohol, and dried. The product was chemically analyzed to be Ce F 4·H2O. KF was prepared by reaction of KOH (chemically pure) with an excess of HF (chemically pure). The resulting solution was evaporated to dryness and the precipitate was heated at 700◦C for complete release of HF. The formula of KF was confirmed by an analysis. HF solution was 39. 93 mass% and contained less than 0. 5 mass% H 2Si F 6. Estimated Error: Solubility: nothing specified. Temperature: precision ±0. 1 K. 3. Solubilityof Praseodymium Fluoride 3. 1. Critical evaluation of the solubility of Pr F 3 (and Pr F 4) in aqueous solutions Components: Evaluators: (1) Praseodymium(III) fluoride; Pr F 3; [13709–46–1] or Praseodymium(IV) fluoride; Pr F 4; [15192–24–2] (2) Water; H 2O; [7732–18–5]T. Mioduski, Institute of Nuclear Chemistry and Technology, Warsaw, Poland; C. Gumi ´nski, Department of Chemistry, University of Warsaw, Poland; and D. Zeng, College of Chemistry and Chemical Engineering, Central South University, Changsha, People’s Republic of China, April 2014 Solubility of Pr F 3in aqueous systems Qualitative information on a very poor solubility of Pr F 3 in H 2O was reported at the beginning of the previous cen- tury. 43,44However, a first quantitative determination of the solubility was only performed six decades later. 9The solubility of Pr F 3in water and aqueous solutions at several tempera- tures and various media has been reported in several publica- tions9,10,12–14,16,19,20,45,46and the results related to the solubility in water are collected in Table 4. Supplementing Table 4, one should add two values of the thermodynamic solubility product of Pr F 3, 1. 4×10−23and 2. 4 ×10−22mol4dm−12at room temperature, which were deter- mined in aqueous solutions containing HNO 3. 45The authors of these results took into account the activity coe fficients of the ions (derived from an unspecified ionic strength dependence) and the dissociation constant of HF, but the calculation method was not completely clear and the solubility product values were strongly dependent on HNO 3concentration. Thus, the results have rather doubtful character. There have been papers devoted to the determinations of Pr F 3solubility in aqueous solutions containing H 2SO4,9,19 H3PO4,19KAl (SO4)2,9or carboxylic acid bu ffers. 10Additions of the components mentioned increased Pr F 3solubility to a different degree, due to the formation of relatively weak HF acid, complexation of Al3+by F−, or complexation of Pr3+by anions of carboxylic acids. Menon et al. 46also investigated the influence of p H on the solubility and found, by similarity to other systems REM F3–H2O, that the lowest level of solubility of Pr F 3was observed at p H about 4; unfortunately, these results had a relative character because they did not fit quantitatively to other solubility determinations of these investigators reported in the same paper. Temperature dependence of the solubility in H 2O was inves- tigated in the temperature range 293–323 K (Ref. 16) and in the temperature range 423–523 K. 20Menon et al. 16did not report the corresponding results in either numerical or graphical form J. Phys. Chem. Ref. Data, Vol. 44, No. 1, 2015 This article is copyrighted as indicated in the article. Reuse of AIP content is subject to the terms at: [URL] Downloaded to IP: 141. 214. 17. 222 On: Mon, 16 Feb 2015 20:30:30 IUPAC-NIST SOLUBILITY DATA SERIES. 100. PART 2 013102-19 T 4. Experimental solubility data of Pr F 3in H 2O. T/K Medium c1(ora1) p Ks(or p Ks0) Method Equilibrium phase References 293 I=0. 02 mol dm−3; p H∼4 or 6 2. 5×10−517. 0 Potentiometric – 13 – 1. 4×10−622. 0 Gravimetric – 19 296 I=0. 01 mol dm−31. 6×10−517. 7 Potentiometric titration – 10 298 – 3. 0×10−516. 7 Conductometric Pr F 3·0. 5H2O 16 and 46 – 2. 0×10−517. 4 Potentiometric Pr F 3·0. 5H2O 16 and 46 298. 2 – 8. 7×10−6a18. 8b Potentiometric Pr F 3 14 0. 1 mol dm−3Na NO 3 3. 8×10−6a20. 2b Potentiometric Pr F 3 12 0. 1 mol dm−3Na NO 3 8. 0×10−619. 0 Potentiometric Pr F 3 12 423 Na Cl O 4–HCl O 4 2. 5×10−6a20. 97b ICP mass spec. and Neutr. activ. anal. Pr F 3 20 473 Na Cl O 4–HCl O 4 1. 0×10−6a22. 56b ICP mass spec. and Neutr. activ. anal. Pr F 3 20 523 Na Cl O 4–HCl O 4 3. 4×10−7a24. 43b ICP mass spec. and Neutr. activ. anal. Pr F 3 20 a Activities ( a1). b Thermodynamic solubility products (p Ks0). and one may only deduce that the solubility of Pr F 3increased with temperature from the thermodynamic parameters of the solubility process, as tabulated in Ref. 16. However, Migdisov et al. 20presented results showing an opposite tendency for the temperature dependence of the solubility. The only explanation of these contradictory facts would be that in the experiments of Ref. 16, the equilibrium solid phase was the hemihydrate Pr F 3·0. 5H2O or even Pr F 3·(3–4)H2O (because Ref. 16 used a freshly precipitated and hydrated form of Pr F 3) and in Ref. 20 the anhydrous form of Pr F 3was used in the solubility determi- nations. Various formulas of the equilibrium solid phase near room temperature were proposed: Pr F 3·0. 4H2O,47 Pr F 3·0. 5H2O,41,46–48Pr F 3·0. 54H 2O,49Pr F 3·0. 55H 2O,27 Pr F 3·0. 76H 2O,28Pr F 3·(0. 5–1)·H2O,26and Pr F 3·H2O. 50We select, in this evaluation, the formula Pr F 3·0. 5H2O as the equilibrium phase in the vicinity of room temperature. It is di fficult to recommend any solubility value at 298 K because there is quite a significant discrepancy between the most convergent results in Refs. 12 and 14
Soluble iron spe- diffraction (XRD) analysis of the ore showed sphalerite cies are the main determinants of redox potential, with (Zn S) (13%); pyrite (Fe S2)(14%), and quartz (Si O2) active iron oxidizing bacteria (Acidithiobacillus ferroox- (18%) as the major components and calcite (Ca CO3) idans, Leptospirillum ferrooxidans) contributing to high (5%) and galena (Pb S) as the minor ones. Chalcopyrite Fe3+/Fe2+ ratios. Precipitation of iron oxide and jarosite (Cu Fe S2) was present in trace amounts. phases in the leaching system may suppress the metal The mesophilic and thermophilic iron oxidizing bac- solubilization by preventing the contact between the teria used in this work were isolated from the Sarchesh- leaching agent and the mineral. The solubility of iron is meh chalcopyrite concentrate (Kerman, Iran) and the defined by the solution redox potential and p H. Kooshk sphalerite concentrate (Yazd, Iran). Mesophilic S. M. Mousavi et al. / Hydrometallurgy 82 (2006) 75-82 77 bacteria used in this work were straight rod-shaped sub-cultured through several transfers in concentrate about 0. 5-1 μm long. During the isolation no endo- medium without ferrous sulfate to adapt the bacteria to spores were observed, and they were motile. Gram test the experimental conditions. The stock cultures were sub- showed that the bacteria were Gram negative, which are cultured at two week intervals. characteristic of A. ferrooxidans. Thermophilic bacteria were rod-shaped about 2-5 μm long that occur singly, in 2. 2. Apparatus and procedure pairs or in short chains. These bacteria were not motile. During the isolation endo-spores were observed, and The experiments were carried out in a column reactor Gram test confirmed that the bacteria were Gram posi- that was fabricated from 5mm thick Plexiglass. The tive, which are characteristic of Sulfobacillus. These column was 220cm high with an internal diameter of strains also were identified by the Department of Micro- 30 cm. A HDPE support plate with multiple 10 mm holes biology in IROST (Iranian Research Organization of was placed on 200 mm high supports allowing air to be Science and Technology). According to the report of injected below the plate and dispersed uniformly over IROST, the strains were identified as A. ferrooxidans and the ore in the column. The column was fed with the Sulfobacillus, respectively. A. ferrooxidans was grown on a bacterial solution using a peristaltic pump at the rate of medium containing Fe SO4:7H2O: 33. 4g/L, (NH4)2SO4: 5L/(m² h); except one test, in order to investigate the 0. 4g/L, Mg SO4:7H2O: 0. 4g/L and K2HPO4: 0. 4g/L. effect of liquid flow rate on zinc extraction. The solution Whilst Sulfobacillus was cultured on a medium containing was applied to the surface of the column charge using a Fe SO4:7H2O: 43. 2g/L, (NH4)2SO4: 3 g/L, Mg SO4:7H2O: simple garden sprinkler head, of the type used in drip 0. 5 g/L, K2HPO4: 0. 5 g/L, KCl: 0. 1 g/L, Ca(NO3)2: 0. 01 g/L irrigation systems. The leach solution was passed through and yeast extract: 0. 2g/L (Ronald, 1997). The cultures of the ore sample by gravity and re-circulated through a side A. ferrooxidans and Sulfobacillus were incubated in loop with a peristaltic pump. In order to maintain feed at 500m L Erlenmeyer flasks each containing 200m L of the 30°C, a water bath was used. A container with a capacity medium and 10% (v/v) inoculum, on a rotary shaker at of 4OL collected the PLS solution draining from the 180rpm at a constant temperature of 33 and 60°C, res- column. The solution level was maintained at a sufficient pectively. The initial p H ofthe cultures was adjusted to p H height to provide a seal, forcing the air upwards through 1. 5 using 0. 5M H2SO4. The stock and pre-inoculum the column charge. The column was insulated with 25 mm cultures were maintained in the same medium under of a fibrous insulation material, known as Alucushion similar conditions. The cultures that were used had been (0. 70W/(m2 K). Four thermocouples were installed at 10 11 4 Fig. 1. Schematic of the heap bioreactor: 1— air compressor, 2— air filter, 3— gas flow meter, 4— air sparger, 5- liquid distributor, 6- temperature sensor, 7- temperature analyzer, 8- peristaltic pump, 9- water bath, 10- mixer, and 11- feed vessel. 78 S. M. Mousavi et al. / Hydrometallurgy 82 (2006) 75-82 12 100 3. Results and discussion 10 8% )uon A significant amount of iron was released from the 60 sulfide minerals during the leaching process. It is evi- 40 dent that a major part of the dissolved iron was sub- sequently hydrolyzed and precipitated as potassium 20 jarosite. The respective ferric iron concentrations in the 0 solution were determined by sulfosalicylic acid spec- 0102030405060708090100110120 troscopy method. However, the sulfate concentrations in Time (Day) the leaching solutions were not systematically analyzed due to the sulfuric acid background. Fig. 2 shows the + total iron →—Zn recovery total iron and zinc concentration values in the presence of Sulfobacillus as a function of time. The average Fig. 2. Variation of the total iron concentration and % Zn extraction in the presence of Sulfobacillus. oxidation rate of zinc increased when soluble ferric iron was present in the leach solution at high concentrations. various locations within the column to measure tempera- The concentrations of ferrous and ferric iron are tures within the charge, as well as the temperatures of the important parameters in bioleaching and are useful as a feed solution, the PLS solution, and the ambient air. In the measure of the biological activity. The changes in the leaching experiments, the column system was comprised concentrations of ferrous and ferric iron during the test of 410kg of ore material and 22L of medium solution are shown in Fig. 3. The trend of Fig. 3 is typical of without ferrous sulfate that contained 10% inoculum with bioleaching in that the biological activity increases after cell density of about 10'cells/m L. The column was an incubation period and temperature increases. The aerated at a rate of 45L/(m² min). Feed and PLS solution bacteria are then better able to oxidize ferrous ion to the were sampled and analyzed to determine solution concen- ferric state. The graph shows a sharp increase in the trations and metal dissolution. For all ofthe tests the initial concentration of ferric iron at day 68. Ferric iron is temperature and p H of the feed were 30°C and 1. 5, important as it plays a key role in the indirect leaching of respectively. Fig. 1 shows the schematic of the apparatus sphalerite. The indirect mechanism for bioleaching in- and locations of the thermocouples. volves the biological regeneration of ferrous ion to ferric after it has oxidized the mineral species, such as sphal- 2. 3. Analysis erite or pyrite. Fowler and Crundwell (1998) found that the role of the bacteria in the bioleaching of zinc sulfide Zinc and total iron concentrations in the bioleached with A. ferrooxidans is that of regenerating the ferric solutions were measured by an atomic absorption spec- iron in the solution. No evidence was found to support trophotometer (German, model AAS 5EA) after the the direct mechanism for bacterial leaching. filtration of the suspension through a 0. 22 μm membrane The p H values during leaching experiments varied filter to remove biomass. The solid residues were air-dried for many reasons. The acid responsible for the very low and samples were taken for chemical analysis and X-ray diffraction (XRD). The bacteria cell number in the solution 10 was determined by direct counting, using a Thoma cham- (V8) 81 ber of 0. 1 mm depth and 0. 0025 mm^ area with an optical 7 microscope (x1000). The ferric iron concentration in the solution was determined by sulfosalicylic acid spec- troscopy method (Varian Techtron UV-VIS spectropho- tometer, model 635) (Karamanev et al. , 2002). The ferrous iron concentration was ascertained by a volumetric method 0+ by titration with potassium dichromate (Vogel, 1962). The 0102030405060708090100110120 p H of the cultural suspension and zinc extractive solution Time (Day) were monitored at room temperature with a p H meter (Metrohm, model 691) and calibrated with a low p H buffer
We suggest that the occurrence of low values of f Ln Gand f Ln Texclusively in regions of high phosphate concentration reflects the extremely low Lnconcentrations in these regions ( Fig. 6 ). Inputs of Ln to the surface ocean are highly spatially heterogeneous including terrigenous input from rivers [ 88], wind-blown dust, subaqueous volcanism and upwelling of nutrient-rich deep water [ 89]. Outputs of Ln from the surface ocean include: 1. Biological uptake; 2. Scavenging via adsorption to sinking particles including a) phytoplanktonbiomass [ 90], and b) clay minerals [ 91]; and 3. Precipitation as Ln PO 4. Outputs 1 and 2a are likely most important in regions where production and export of organic matter is high. However, these effects may be lessened by the replenishment of Ln to the surface ocean that accompanies the replenishment of whichever nutrient limits phytoplankton growth rate (e. g. wind-born Fe and Ln from dust in the Southern Ocean [ 92,93]). The efficiency of adsorption reactions (outputs 2a and 2b) depends on the concentration of the free Ln3+ion, which increases with decreasing p H, as a higher fraction of total Ln is in the form Ln3+due to the decreased abun- dance of the dominant inorganic ligand, CO 32−(Fig. 6B ). Ln PO 4is a highly insoluble salt (K sp∼10−26-1 0−25[94]). Rates of Ln PO 4 precipitation are greater in waters that are more oversaturated with respect to Ln PO 4. Output 3, therefore, depends on the sol- ubility product [Ln3+][PO 43−]. The concentration of the PO 43−ion increases with p H and total phosphate, while the free Ln3+ion is a smaller fraction of total Ln at high p H [ 95]. The opposing effects of p H on Ln3+and PO 43−result in a subtle optimum relationship, with lowest concentrations of total Ln at Ln PO 4saturation occur- ring at around p H 8. 1, and modest increases at lower or higher p H (Fig. 6C ). The value of [Ln3+][PO 43−] is most strongly determined by the concentration of total phosphate ( Fig. 6C ). This is supported by the strong negative relationships between total phosphate and f Ln Gand f Ln T(Fig. 5B and 5D). We conclude that Ln scavenging efficiency is likely most strongly controlled by p H (higher at low p H), while La PO 4Downloaded from [URL] by guest on 22 July 2025 12 \|Voutsinos et al. precipitation is most strongly controlled by phosphate (higher at high total phosphate). In the ocean, phosphate concentrations and p H negatively covary, so these removal fluxes cannot currently be decoupled. However, both processes will be moreefficient where phosphate is high and p H is low such as the high- latitude HNLC regions, and less efficient where PO 4is low and p H is high such as the ocean gyres ( Fig. 5 and 6). Even accounting for these processes, there is a large spread in both f Ln Gand f Ln T, the simplest explanation for which is that inputs of Ln are temporally and spatially variable. At high p H and low phosphate, there is negligible depletion of surface ocean Ln, which is always available at sufficient concentrations (f Ln Tis always high), while at low p H and high phosphate, the steady state concentration depends on the balance between inputs and outputs (f Ln Tcan be high and low). Discussion Evolutionary trade-offs between Ln- and Ca- dependent DHs Our results reveal that Ln-dependent forms of PQQ-DHs domi- nate over the canonical Ca-dependent forms, despite the billion- fold higher concentrations of Ca over Ln in seawater. Ln are superior Lewis acids to Ca, and have been predicted to be moreeffective activators of the redox cofactor PQQ [ 96]. This contrast between Ln and Ca in enzyme efficiency and metal availability in natural environments highlights an evolutionary trade-off whichour results show strongly favors quality over quantity of the available metal cofactor. Only in those regions of the ocean where stable Ln concentrations are practically zero (i. e. HNLC regionswhere phosphate concentrations are extremely high) do we find communities where Ca-dependent forms are favored. Although expression is dominated by MDH in the surface ocean and by ADHs at depth, our results also suggest that the lanthanides have metabolic functions beyond a role in the oxi- dation of volatile alcohols and aldehydes. The diverse familiesof Ln-dependent putative monosaccharide dehydrogenases, par- ticularly GDH, are phylogenetically widespread ( Fig. 2A ), but are not highly expressed ( Fig. 3B , D, F, H). These monosaccharide dehydrogenases may play an important metabolic role in the modern ocean, but only in certain circumstances not captured in the data. Ln concentrations in Archean seawater when bacteria evolved were likely much higher than today, owing to low p H and low phosphate concentrations (which may have been very low[ 97,98], however this remains hotly debated [ 99,100]), and would have decreased significantly via scavenging by iron oxides during the oxygenation of the ocean. A deep evolutionary origin for Ln-dependent MDH has been proposed previously [ 13]. Our results support this conclusion and further suggest that bacterial Ln- dependent enzymes might have been more important during theearly evolution of aerobic respiration than today. Climatic implications of a coupling between Ln and C cycles We showed that methanol dehydrogenases are the most highly expressed Ln-dependent enzymes in the surface ocean. Whilewe hypothesize that the source of methanol is planktonic algae, methanol cycling in the surface ocean is poorly understood. The absence of methane marker genes in the samples represented inthe dataset does not preclude the likely importance of methane- derived methanol in regions not captured in this dataset. The availability of Ln in seawater is a function of p H, and thus is sen-sitive to changing seawater CO 2concentrations associated with Anthropogenic emissions. If Ln-dependent methane oxidation is a significant process in the modern ocean, it would constitute a sink of a highly potent greenhouse gas. This sink would be p H dependent, and thus an important biogeochemical climate feed-back that should be investigated. Future work should therefore target regions of methane influx to the ocean such as shelf regions where massive amounts of methane are released from subsurfacedeposits, and submarine volcanism. The coupling between the marine Ln and carbon cycles likely has implications for Earth’s climate ( Fig. 6 ). These interactions may drive climate feedbacks, for example, in Anthropogenic future oceans, the efficiency of Ln scavenging will likely increasefollowing decreases in seawater p H. On longer timescales oceanic phosphate concentrations are projected to increase on millennial timescales as a result of increased weathering [ 101], which would likely cause an increase in Ln PO 4precipitation. Both effects would drive a decrease in the surface ocean concentration of Ln, and therefore a reduction in the rate of Ln-dependent alcoholoxidation to CO 2, manifesting as a negative feedback to increasing atmospheric p CO 2. Implications for understanding biogeochemical Ln patterns Lanthanide concentrations in seawater exhibit nutrient-like ver- tical profiles, being low in surface waters, and increasing, and ultimately plateauing, with depth [ 30]. Such profiles are typically reflective of biological uptake and remineralization at depth. The concentration profiles of Ln have been reconciled with their assumed lack of biological utility with various scavenging models. However, our findings demonstrate that Ln is indeed a nutrient,and therefore that such behavior should be expected. Usually referred to as the REEs in the field of ocean geochem- istry, the relative concentrations of Lns in seawater and in sed-iments have been extensively used to explore ocean circulation and hydrothermalism in the modern ocean and over geologic time [ 102]. With the exception of Ce, which is oxygen sensitive, differences in the efficiency of removal fluxes between the Lns are attributed to relative stability of aqueous complexes [ 95]. Biological utilisation of Ln in seawater has, until very recently,been assumed to be unimportant [ 31]. The deepwater horizon disaster in the Gulf of Mexico provided the first circumstantial evidence of biological Ln utilisation. During this event, a rapid increase in water column methane concentrations drove a bloom in water column methanotrophy that was coincident with a dra-matic decrease in the lightest Ln in seawater [ 24]. Our results show that biological Ln utilisation is not restricted to discrete events or to methanotrophy, but is ubiquitous and diverse. Microbialuptake and export thus likely imparts a previously unaccounted for fractionation of the Lns, with more efficient uptake of the light rare earths over the heavy rare earths which must be constrainedand factored into future geochemical analyses. Potential industrial applications Despite their significant economic value, efficient extraction and purification of Ln from raw materials remains an unsolved chal- lenge [ 103]. The methylolanthanin-bearing organisms that we highlight will be appealing targets for use in bioleaching and biomining efforts. Biological utilisation also discriminates heavily between Ln. Observed bacterial utilisation of lanthanides has thusfar only involved La to Gd, and recently Pm [ 104] (even though it does not exist in nature), with a preference for the lightest Ln of the series, La, Ce, and Nd
It has been argued, though, that a plurality of approaches may be more realistic and even preferable (Winter, 2016a). States also have responsibility for transboundary harm. There is an international customary rule that a state must prevent and provide compensation for damage wrongfully caused from its territory to other states [ICJ Pulp Mills 2010]. The International Law Commission has concretised the general rule by developing Draft Articles on Responsibility of States for Internationally Wrongful Acts, which provide an obligation to make reparation for “any damage, whether material or moral, caused by the internationally wrongful act of a State”[ILC Draft Articles 2001, art. 31]. The obligation has been partly applied to biosafety issues by the Nagoya- Kuala Lumpur Supplementary Protocol on Liability and Redress, which had only 42 Parties as of 2018. In addition to the “ex post” liability approach, the principle of state responsibility for transboundary harm implicates an “ex ante” approach in the form of a responsibility to conduct environmental impact assessments where there is potential for significant transboundary adverse impact [ICJ Pulp Mills 2010; UNCLOS art. 206]. Depending on scope, this could apply in cases where synthetic biology or engineered gene drives cross boundaries. The Cartagena Protocol further stipulates that export of GMOs requires prior informed consent of the importing state. However, as of 2018, some of the most active states in biotechnology are not among the 171 Contracting Parties of the Protocol, including the United States, Australia, Canada, Russia, Israel and Chile. Failure to comply with prior informed consent and EIA obligations would possibly qualify as a wrongful act in the sense of the international customary rule and Draft Articles described above. Recognising the potential for harm in the absence of wrongful activities, the International Law Commission of the United Nations developed Draft Principles on the Allocation of Loss in the Case of Transboundary Harm Arising out of Hazardous Activities [2006], which would require states to impose strict liability on operators of hazardous activities, and require operators to have financial security, such as insurance, to cover compensation claims [ILC Draft Principles 2006]. It is however open to debate whether synthetic biology could be considered a “hazardous activity” as understood by the Draft Principles (see Section 2. 2). 2. 1. 3 Access to information, public participation and access to justice in environmental matters Procedural norms of good governance apply to decision making on activities related to or potentially impacting biodiversity and the natural environment. These include three key components: access to information; public participation in decision-making processes; and access to justice [SDG 16; Rio Declaration Principle 10]. These components have a long tradition in several legal systems, including the United States (Stewart, 2003). They were further elaborated in the Aarhus Convention on Access to Information, Public Participation in Decision-making and Access to Justice in Environmental Matters [1998]. The Aarhus Convention, while European in scope, provides guidance on interpretation of the three aspects, that have been recognised as globally relevant (Morgera, 2005). According to the Aarhus Convention, the principle of access to information requires that any person has the right of access to environmental information held by public authorities, including private actors with public functions, notwithstanding exceptions concerning the protection of privacy, trade secrets and certain public interests [Aarhus art. 4]. The principle of public participation provides for a right of the public at large and particularly concerned persons to participate early in decision-making processes in relation to certain hazardous activities or environment-related plans, programmes and executive regulations [Aarhus arts. 6-8]. The principle of access to justice in environmental matters states that any person – which includes any environmental organisation – who considers their rights violated or interests affected by an environmental decision has access to a court or other independent and impartial review procedure to challenge the substantive and procedural legality of the decision [Aarhus art. 9]. The Aarhus Convention explicitly applies these principles to matters related to genetically modified organisms [Aarhus art. 2(3)(a), art. 6(11)]. 2. 1. 4 Peoples’ rights to self- determination and free prior and informed consent Synthetic biology decision making can implicate rights of indigenous peoples and local communities in relation to natural resources and culture. The principle of self- determination of peoples, recognised in the Charter of the United Nations, the International Covenant on Civil and Political Rights, the International Covenant on Economic, Social and Cultural Rights, entails a right to control over natural wealth and resources [UN Charter art. 55; ICCPR art. 1; ICESCR art. 1]. The UN Declaration on the Rights of Indigenous Peoples and International Labour Organization (ILO) Convention 169 elaborate the rights of indigenous and tribal peoples to participate in the use, management and conservation of resources pertaining to their lands. ILO Convention 169 requires governments to “respect the special importance for the cultures and spiritual values of the peoples concerned of their relationship with the lands or territories, or both as applicable, which they occupy or otherwise use. ” [ILO Convention 169 art. 14]. A series of international human rights cases have highlighted the special relationship between indigenous peoples and their traditional territory and resources and found that interference with rights of communities related to their natural resources can implicate the human right to culture [e. g. HRC “Lubicon Lake Band” 1984; IACHR “Awas Tingni” 2001; ACHPR “Endorois” 2009]. In practice, these rights are realised through procedural requirements for involvement of communities in decision making. The UN Declaration on Rights of Indigenous Peoples provides that indigenous peoples shall not be relocated from their lands or territories without their free, prior and informed consent [art. 10]. The concept of free prior and informed consent (FPIC) has been extended to apply to any decision making related to activities affecting the territory or natural resources of indigenous peoples or communities. For instance, financial institutions have included FPIC in the Equator Principles, a risk management framework for determining, assessing and managing environmental and social risk in projects (Amalric, 2005). Human Rights Tribunals have found that FPIC entails good faith and culturally appropriate consultation, sufficient sharing of information including environmental and social impact studies in advance of decisions, and appropriate monitoring [IACHR “Saramaka” 2007; ACHPR “Ogoni” 2001; IACHR “Maya” 2004]. Free, prior and informed consent has been largely discussed in the context of conservation for decisions impacting indigenous peoples and local communities. In its recent report, the CBD’s Ad Hoc Technical Expert Group on Synthetic Biology noted that “free, prior and informed consent of indigenous peoples and local communities, might be warranted in the development and release of organisms containing engineered gene drives” (Ad Hoc Technical Expert Group on Synthetic Biology, 2017, para. 25). The AHTEG also stated that the development of synthetic biology technologies “should be accompanied by the full and effective participation of indigenous peoples and local communities” (para. 26). In 2018, the CBD COP called upon Parties and other Governments to obtain, as appropriate, free, prior and informed consent or approval and involvement of potentially affected indigenous peoples and local communities as a prerequisite to introducing engineered gene drives into the environment, in accordance with national circumstances and legislation [COP/14/L. 31 para. 9, 11]. 2. 1. 5 Inter-generational equity and sustainable development Synthetic biology has potential benefits and adverse effects that could affect resource management and economic development now and for future generations. The concept of sustainable development is defined as development that “meets the needs of the present without compromising the ability of future generations to meet their own needs” (World Commission on Environment and Development, 1987). It recognises that economic and social development and environmental conservation are interdependent [Rio Declaration, Principle 4]. It is linked to the principles of intergenerational equity, which entails an obligation of stewardship of the natural environment for future generations, and intragenerational equity which emphasises the need to meet the basic needs of current generations across circumstances and regions (Brown Weiss, 1993; [ICJ Nuclear Test Case, 1995, Weeramantry dissenting; ICJ Gabcikovo-Nagymaros, 1997, Weeramantry concurring; Minors Oposa, 1993]). The Sustainable Development Goals (SDGs) adopted in 2015 provide globally agreed upon targets for alleviating poverty, ensuring food security, combating climate change and conserving biological diversity. Certain applications of synthetic biology are intended to provide a means for realising sustainable development goals. For example, applications to address invasive species could contribute to goals related to terrestrial and marine conservation [SDGs 14 and 15], while applications addressing human disease vectors such as mosquitos support achievement of goals on human health and well-being as well as alleviation of poverty [SDGs 1 and 3]. At the same time, some of the risks associated with synthetic biology could affect attainment of these goals in a different way (see Section 2. 2). The potential benefits and risks of synthetic biology are discussed in more detail in Chapters 5 and 6. 2. 2 Governance frameworks relevant to synthetic biology impacts on biodiversity Synthetic biology engages existing normative systems, including legal, customary and industry systems, at the international, regional, national and subnational levels. These include frameworks governing risk assessment and management, liability for harm, intellectual property and ownership, and sharing of benefits. Table 2. 1 provides a summary of relevant international legal regimes. Many of the existing governance frameworks were developed in the context of “traditional” genetic engineering and may have to be revised in order to cope with challenges raised by synthetic biology (Wynberg & Laird, 2018). These challenges are addressed in depth in Section 2. 3. This section first explores international and national legal instruments and approaches in relation to risk assessment, liability, intellectual property, and access and benefit sharing
Some meta l ABC importers have been 731 biochemically and structurally characterized, but n o purification and reconstitution of 732 iron/siderophore membrane transport system has been carried out at the present time. 733 Several studies have however appeared on a few heme transport systems that will now 734 be described. 735 736 737 738 24 -Shigella dysenteriae Shu TUV 739 The first one concerned the Shu TUV system from Shigella dysenteriae that was 740 reconstituted in artificial membrane vesicles[90], with the SBP Shu T trapped inside the 741 vesicle lumen, and the presence of an heme trap, Sh u S in the medium. The extent of 742 heme binding to apo Shu S was measured, as well as t he ATP hydrolysis. Two types of 743 mutants were also used, one with mutations in the t wo conserved glutamate residues on 744 Shu T that serve to anchor Shu T to Shu U, and also on two histidine residues on Shu U, 745 that were tentatively assigned a heme binding funct ion. All mutants and the WT apo 746 Shu T displayed a basal level of ATPase activity and no heme accumulation on Shu S, 747 whereas the holo-Shu T led to an increase in ATPase activity, coupled to a transfer from 748 the heme from Shu T to Shu S. Although this study pro vided an interesting insight into the 749 functioning of of a type II heme importer, no furth er studies have appeared, to precisely 750 measure stoichiometries, coupling parameters, and r elevant kinetics. 751 752 -Yersinia pestis Hmu TUV 753 A second study on the Hmu TUV heme acquisition syste m from Y. pestis did use a 754 slightly different way to measure heme uptake acros s the vesicle membrane, with the 755 binding protein on the extracellular side of the ve sicle and, trapped inside the vesicle an 756 ATP regenerating system. Heme was measured based on its peroxidase activity, after 757 binding to apo-HRP [91]. As in the previous case, t he transport of heme was strictly 758 dependent upon the ATP hydrolysis, and of the corre ct association of the SBP with the 759 transporter. Transport rates of ca. 0. 14 molecule o f heme transported per min and per 760 Hmu UV transporter, were measured, comparable to tho se observed previously. If these 761 rates truly represent in vivo activity they are cle arly not as efficient as the maltose 762 transporter (ca 20 maltose molecules transported by transporter by minute), which 763 they don’t need to be. The same Hmu T mutant was use d, unable to dock to Hmu UV, and 764 a Walker-B mutant in Hmu U (E173Q) also inhibited tr ansport. The Hmu UV structure 765 was solved by X-ray crystallography and showed the typical arrangement of type II ABC 766 importers. There is a two fold symetry axis, perpen dicular to the membrane plane. Each 767 Hmu U subunit presents 10 TM segments, the coupling helix between TM 6 and 7 768 establishes contacts with the ABC subunits. At the interface of the Hmu U monomers 769 there is a cavity open to the extracellular side an d delimited by helices 5, 5a and 10 of 770 both monomers (Fig. 4). This cavity is rather apola r and large enough to accomodate a 771 25 heme molecule. Neither Hmu UV or Hmu TUV purified in detergent displays a detectable 772 heme affinity. Furthermore, the two histidines resi dues identified in the work on 773 Shu TUV are clearly facing the cytoplasm, and given their position on the structure, their 774 potential role in heme binding is questionable ; th ey could be in contact with the ABC 775 subunits at some point of the reaction cycle. Two r esidues Arg176, and Gly164 776 completely conserved in the Hmu U family, were mutat ed for Ala. Arg176 is exposed on 777 the periplasmic side, at the entrance of the putati ve heme binding cavity and Gly 164 is 778 lower in the cavity, at a narrowing of the cavity. A strong effect was observed with the 779 R176A mutant, that displayed the same basal ATPase activity as the WT, but almost no 780 stimulation by Hmu T ; this correlated with a weak b inding of Hmu T to Hmu UV. The 781 Gly164Tyr mutant showed increased basal ATPase acti vity, with very little stimulation 782 by Hmu T, and a very reduced transport activity, ind icating uncoupling of the ATPase 783 from the transport activities. Although rather unli kely, it would have been interesting to 784 test whether this mutation might have provided a bi nding site for heme in the cavity. 785 Another study using surface plasmon resonance with immobilized Hmu UV and 786 Hmu T in the running buffer showed that Hmu T binds w ith nanomolar affinity to Hmu UV, 787 and that both ATP and an excess of heme lead to the dissociation of the Hmu T-Hmu UV 788 complex [92], strengthening thesimilarities between the heme and B12 transporters. 789 790 Contrarily to Mal FGK2 or Sav1866, that are outward facing in the presence of 791 ATP, and inward facing in absence of nucleotide, th e opposite orientation is found in the 792 case of Btu CD or Hmu UV, consistent with their class ification as type II importers, where 793 the complex is outward facing in the absence of ATP. There are at least two other 794 characterisitics of this type II ABC importers that are worth mentioning : one which is 795 related to the number of molecules that are transpo rted that are orders of magnitude 796 lower in the case of either siderophore/heme or B12 vitamin as compared to a carbon 797 source as maltose; an E. coli cell contains ca. a few hundred thousand iron atom s that it 798 must acquire during a cell division time. Unfortuna tely, the number of transporters per 799 cell is not known for all those systems; however th e observed in vitro rate of ATPase 800 hydrolysis is ca. 10 times higher in the case of th e maltose transporter as compared to 801 the Hmu transporter. Whether this is related to the catalytic activity of those various 802 transporters remains to be determined. The other ch aracteristics concerns the 803 amplitude of the movements of the binding protein i n the bound and free states in the 804 26 two systems where it is much smaller in the siderop hore/heme case, as compared to the 805 maltose case. Finally, there is also a difference c oncerning the ligand accessibility in the 806 SBP’s of the two classs, whereby class III SBP’s ha ve their substrate at least partially 807 exposed to the outside, which is not the case in cl ass I or II SBP’s. 808 809 -Burkholderia cenocepacia Bhu UV 810 Another heme importer Bhu UV from Burkholderia cenocepacia has been 811 crystallized, in an ATP-free form, and also in the presence of the heme-SBP Bhu T, in the 812 absence of heme [58, 93]. There are several differe nces as compared to the Hmu UV 813 structure of Y. pestis. First of all, the Bhu UV structure is open on the cytoplasmic side, 814 contrarily to the Hmu UV case (Fig. S23). As in the Hmu UV case, there is a dimerization of 815 Bhu U along TM 5 and 10 of each Bhu U monomer. The ch annel that extends throughout 816 the Bhu U dimer interface is blocked on the periplas mic side by the two helices 5a, that 817 form the periplasmic gate mentioned above. On the c ontrary, the channel is open on the 818 cytoplasmic side, as it can be clearly seen on eith er Figure. As in the Hmu UV case, the 819 cavity is largely apolar with the exception of a co nserved aspartate residue (Asp 112 in 820 Bhu U, Asp86 in Hmu U), that, given its position coul d fulfil a specific function. Actually 821 mutants of this residue (D112A or D112V) still disp lay basal ATPase activity, similar to 822 the WT protein, but are no longer able to transport heme. In the presence of the Bhu T 823 SBP, the ABC domains are slightly more close to eac h other. 824 825 When the Bhu TUV complex is formed from holo-Bhu T an d ATP free Bhu UV, the 826 complex is no longer coloured, and heme is not foun d on the complex. This is 827 understandable, as the periplasmic gating loops fro m both Bhu U, insert into the heme 828 binding pocket and come into steric clash with the heme, if it were to stay on its binding 829 site. Finally, upon Bhu T fixation the heme binding pocket resembles more the open apo 830 form than the closed form (Fig. 5)
Pe3ynb Ta TH re Hepauii AΦK 山ypi B, 山o OTp UMa- The results of ROS generation of rats obtained by flow JN 3a HOn OMOr OO np OTOy Hoi μUTOMe Tpii, npe ACTa Bne Hi cytometry are presented in the figure 2-4. Ha puc. 2-4. The results of our experimental studies are consistent OTp UMa Hi Ha MW pe3ynb Ta TH e KCnep UMe HTanb HUX with the data of the scientific literature on the study of the HOCniμxe Hb y3r OμXy IOTb CA 3 Ha HUMN Hay KOBOi ni Tepa- effect of NPs on the antioxidant system of the cell. Typ U 山OμO BUBYe HHA BNNNBy HY Ha a HTHOKCUAa HTHy It was revealed that Gd YVO NPs (d = 2nm) effectively CHCTe My Kni TИHU. Byn O BUABne HO, 山O HY Gd YVO (d = scavenge hydroxyl radicals, superoxide anions, hydrogen 2 HM) epe KTИBHO n Orn NHa IOTb riμp OKCUnb Hi pa AUKan H, peroxide, peroxyl radicals, and remarkably reduce Op Uri Hanb Hi μOCni A*e HHA 201 Original research Bic HNK Xap Ki BCb KOr O Ha Li OHanb HOr O y Hi Bep CUTe Ty i Me Hi B. H. Kapa3i Ha. ISSN 2313-2396 (Online) Cepig Me AHLИHa. 2025. T. 33 No 2(53). C. 194-210 ISSN 2313-6693 (Print) The Journal of V. N. Karazin Kharkiv National University. Series Medicine. 2025;33(2(53)):194-210 Allvens264 A) B) Pnc. 2. Penpe3a THBHa μMTorpa Ma (A) Ta ric Torpa Ma SSC/FL1 (2',7'-Auxnop Auriapocpnyopecuei Hy Aiaue Ta Ty) (B) nen KOμNTi B 山ypa Ne 3 3 rpynn 1. Cepe AHe 3Ha4e HH9 5471,23 Fig. 2. Represative cytogram (A) and histogram of SSC/FL1 (2',7'-dichlorodihydrofluorescein diacetate) (B) of leukocytes of a rat No. 3 from group #1. The average value is 5471. 23 f7Ma Ma24391 A) B) Pnc. 3. Penpe3a THBHa μμTorpa Ma (A) i ric Torpa Ma SSC/FL1 (2',7'-Auxnop Auriapocnyopecuei Hy Aiaue Ta Ty) (B) ne Nkou NTi B 山ypa Ne 1 3 rpynn 2. Cepen He 3Ha4e HH9 5213,37 Fig. 3. Represative cytogram (A) and histogram of SSC/FL1 (2',7'-dichlorodihydrofluorescein diacetate) (B) of leukocytes of a rat No. 1 from group #2. The average value is 5213. 37 m(11） Specimen_001_w BC_FDA_Gd100_UV. fcs events100ts100. 00s 4 035,4429393 Madia9327,72 A) B) Pnc. 4. Penpe3a THBHa μMTorpa Ma (A) i ric Torpa Ma SSC/FL1 (2',7'-AMxnop Auriapocpnyopecuei Hy Aiaue Ta Ty) (B) neikoun Ti B wypa Ne 1 3 rpynn 4. Cepen He 3Haye HH9 4035,44 Fig. 4. Represative cytogram (A) and histogram of SSC/FL1 (2',7'-dichlorodihydrofluorescein diacetate) (B) of leukocytes of a rat No. 1 from group #4. The average value is 4035. 44 Op Uri Hanb Hi AOCni ZKe HHA 202 Original research Bic HNK Xap Ki BCb KOr O Ha Li OHanb HOr O y Hi Bep CUTe Ty i Me Hi B. H. Kapa3i Ha. ISSN 2313-2396 (Online) Cepig Me AHμNHa. 2025. T. 33 No 2(53). C. 194-210 ISSN 2313-6693 (Print) The Journal of V. N. Karazin Kharkiv National University. Series Medicine. 2025;33(2(53)):194-210 cynep OKCHA-a Hi OHN, nepe KUC BOμHIO, nep OKCUnb Hi pa AH- the lipopolysaccharide-induced ROS generation in rat Kan N Ta 3Ha4HO 3Me HWy IOTb i HAy KOBa He Jinon Onicaxap H- leukocytes [27]. AOM y TBOpe HHA AΦK y Je NKOu NTax 山ypi B [27]. With regard to the groups of animals exposed to CTOCOBHO rpyn TBap UH, 9Ki niμn9rann Ai p O34NHi B HY solutions of NPs of orovanadate gadolinium yttrium at Op OTOBa Hana Ty ran Oni Hiv-i Tpio B AO3i 20O MKr/kr Ma CH a dose of 200 μg/kg of body weight, without preceding Tina, 6e3 n Onepen Hboro yΦ-onpo Mi He HHA (3-TA rpyna, UV irradiation (group #3, Gd-200), there was a significant Gd-200) CHOCTepira ETb CA 3Hay MMe 3Me HWe HH9 re Hepauiil decrease in the generation of ROS in leukocytes relative AΦK y Jen KOLNTax Bin HOCHO rpyn N KOHTponio, (p < 0,05). to the control group (p < 0. 05). When a solution of yttrium p U BBe Ae HHi TBap WHa M p O34NHy Ha HOHa CTИHOK Op OTOBa- gadoline orovanadate nanoparticles was administered to Hana Ty raμoni Hin-i Tpio, n Onepen Hbo yΦ-onpo Mi He Hoi μ03M animals, with a pre-UV irradiated dose of 200 μg/kg of 200 Mkr/kr Mac H Tina (5-Ta rpyna, Gd(UV)-200), 3Haye HHA n O- body weight (group #5, Gd(UV)-200), the value of ROS Ka3HNKa y TBOpe HHA AΦK y Je NKOLNTa X 山ypi B 36inb山y ETb CA formation in rat leukocytes increased by almost 15% npa KTW4HO Ha 15% Bi HOCHO KOHTp Onb Hoi rpyn N (Ta6n. 1). compared to the control group (Table 1). And for the og CHe HHA CIOCTepe Ke HNX ecpe KTi B 6yne 06ro BOpe- groups of animals exposed to solutions of orovanadate HO HN)X4e. yttrium gadolinium at a dose of 200 μg/kg of body weight, p W n Opi BHAHHi rpyn TBap UH, AKi 3a3Ha Ban N Ai p O34U- without preceding UV irradiation (group #3, Gd-200), Hy Ha HO4a CTИHOK Op OTOBa Hana Ty raμOni Hi-i Tpiro B AO3i there was a significant decrease in the generation of 100 Mkr/kr Macn Tina (2-ra rpyna, Gd-100) i200 mkr/kr ROS in leukocytes relative to the control group, (p<0. 05). (3-T9 rpyna, Gd-200), 6e3 nonepen Hboro onpo Mi He HHA Ha When a solution of orovanadate yttrium gadolinium n OKa3HUKW re Hepauii AΦK y Jev Kou NTax 山ypi B, y Ka3yi OTb nanoparticles was administered to animals, with a pre-UV Ha 3Ha4MMe 3Me HWe HHA Lb Or O n OKa3HUKa y TBap NH 3-i rpy- irradiated dose of 200 μg/kg of body weight (group #5, N, B HOpi BHAHHi 3 TBap UHa MN 2-i rpyn N (p < 0,05) (Ta6n. 1)
; Bellenberg, S. ; Mamani, S. ; Ruiz, L. ; Echeverria, A. ; Soulere, L. ; Doutheau, A. ; Demergasso, C. ; Sand, W. ; Queneau, Y. ; et al. AHL signaling molecules with a large acyl chain enhance biofilm formation on sulfur and metal sulfides by the bioleaching bacterium Acidithiobacillus ferrooxidans. Appl. Microbiol. Biotechnol. 2013 ,97, 3729–3737. [Cross Ref] [Pub Med] 22. Mamani, S. ; Moiner, D. ; Denis, Y. ; Soulere, L. ; Queneau, Y. ; Talla, E. ; Bonnefoy, V. ; Guiliani, N. Insights into the Quorum Sensing Regulon of the Acidophilic Acidithiobacillus ferrooxidans Revealed by Transcriptomic in the Presence of an Acyl Homoserine Lactone Superagonist Analog. Front. Microbiol. 2016 ,7, 1365. [Cross Ref] [Pub Med] 23. Valdes, J. ; Pedroso, I. ; Quatrini, R. ; Holmes, D. S. Comparative genome analysis of Acidithiobacillus ferrooxidans , A. thiooxidans and A. caldus : Insights into their metabolism and ecophysiology. Hydrometallurgy 2008 ,94, 180–184. [Cross Ref] 24. Ruiz, L. M. ; Castro, M. ; Barriga, A. ; Jerez, C. A. ; Guiliani, N. The extremophile Acidithiobacillus ferrooxidans possesses a c-di-GMP signalling pathway that could play a signiﬁcant role during bioleaching of minerals. Lett. Appl. Microbiol. 2012 ,54, 133–139. [Cross Ref] [Pub Med] 25. Castro, M. ; Deane, S. M. ; Ruiz, L. ; Rawlings, D. E. ; Guiliani, N. Diguanylate cyclase null mutant reveals that c-di-GMP pathway regulates the motility and adherence of the extremophile bacterium Acidithiobacillus caldus. PLo S ONE 2015 ,10. [Cross Ref] [Pub Med] 26. Römling, U. ; Galperin, M. Y. ; Gomelsky, M. Cyclic di-GMP: The ﬁrst 25 years of a universal bacterial second messenger. Microbiol. Mol. Biol. Rev. 2013 ,77, 1–52. [Cross Ref] [Pub Med] 27. Jenal, U. ; Reinders, A. ; Lori, C. Cyclic di-GMP: Second messenger extraordinaire. Nat. Rev. Microbiol. 2017 , 15, 271–284. [Cross Ref] [Pub Med] Genes 2018 ,9, 113 13 of 15 28. Ross, P. ; Weinhouse, H. ; Aloni, Y. ; Michaeli, D. ; Weinberger-Ohana, P. ; Mayer, R. ; Braun, S. ; de Vroom, E. ; van der Marel, G. A. ; van Boom, J. H. ; et al. Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature 1987 ,325, 279–281. [Cross Ref] [Pub Med] 29. Lee, V. T. ; Matewish, J. M. ; Kessler, J. L. ; Hyodo, M. ; Hayakawa, Y. ; Lory, S. A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Mol. Microbiol. 2007 ,65, 1474–1484. [Cross Ref] [Pub Med] 30. Guttenplan, S. B. ; Kearns, D. B. Regulation of ﬂagellar motility during bioﬁlm formation. FEMS Microbiol. Rev. 2013 ,37, 849–871. [Cross Ref] [Pub Med] 31. Hengge, R. Trigger phosphodiesterases as a novel class of c-di-GMP effector proteins. Philos. Trans. R Soc. Lond. B Biol. Sci. 2016 ,371. [Cross Ref] [Pub Med] 32. Sudarsan, N. ; Lee, E. R. ; Weinberg, Z. ; Moy, R. H. ; Kim, J. N. ; Link, K. H. ; Breaker, R. R. Riboswitches in Eubacteria Sense the Second Messenger Cyclic Di-GMP. Science 2008 ,321, 411–413. [Cross Ref] [Pub Med] 33. Amikam, D. ; Galperin, M. Y. Pil Z domain is part of the bacterial c-di-GMP binding protein. Bioinformatics 2006 ,22, 3–6. [Cross Ref] [Pub Med] 34. Newell, P. D. ; Monds, R. D. ; O’Toole, G. A. Lap D is a bis-(30, 50)-cyclic dimeric GMP-binding protein that regulates surface attachment by Pseudomonas ﬂuorescens Pf0-1. Proc. Natl. Acad. Sci. USA 2009 ,106, 3461–3466. [Cross Ref] [Pub Med] 35. Hickman, J. W. ; Harwood, C. S. Identiﬁcation of Fle Q from Pseudomonas aeruginosa as a c-di-GMP-responsive transcription factor. Mol. Microbiol. 2008 ,69, 376–389. [Cross Ref] [Pub Med] 36. Tao, F. ; He, Y. W. ; Wu, D. H. ; Swarup, S. ; Zhang, L. H. The cyclic nucleotide monophosphate domain of Xanthomonas campestris global regulator Clp deﬁnes a new class of cyclic di-GMP effectors. J. Bacteriol. 2010 , 192, 1020–1029. [Cross Ref] [Pub Med] 37. Jones, C. J. ; Utada, A. ; Davis, K. R. ; Thongsomboon, W. ; Zamorano Sanchez, D. ; Banakar, V. ; Cegelski, L. ; Wong, G. C. ; Yildiz, F. H. C-di-GMP Regulates Motile to Sessile Transition by Modulating Msh A Pili Biogenesis and Near-Surface Motility Behavior in Vibrio cholerae. PLo S Pathog. 2015 ,11. [Cross Ref] [Pub Med] 38. Lori, C. ; Ozaki, S. ; Steiner, S. ; Böhm, R. ; Abel, S. ; Dubey, B. N. ; Schirmer, T. ; Hiller, S. ; Jenal, U. Cyclic di-GMP acts as a cell cycle oscillator to drive chromosome replication. Nature 2015 ,523, 236–239. [Cross Ref] [Pub Med] 39. Franklin, M. J. ; Nivens, D. E. ; Weadge, J. T. ; Howell, P. L. Biosynthesis of the Pseudomonas aeruginosa Extracellular Polysaccharides, Alginate, Pel, and Psl. Front. Microbiol. 2011 ,2, 167. [Cross Ref] [Pub Med] 40. Vasseur, P. ; Vallet-Gely, I. ; Soscia, C. ; Genin, S. ; Filloux, A. The pelgenes of the Pseudomonas aeruginosa PAK strain are involved at early and late stages of bioﬁlm formation. Microbiology 2005 ,151, 985–997. [Cross Ref] [Pub Med] 41. Jennings, L. K. ; Storek, K. M. ; Ledvina, H. E. ; Coulon, C. ; Marmont, L. S. ; Sadovskaya, I. ; Secor, P. R. ; Tseng, B. S. ; Scian, M. ; Filloux, A. ; et al. Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the Pseudomonas aeruginosa bioﬁlm matrix. Proc. Natl. Acad. Sci. USA 2015 ,112, 11353–11358. [Cross Ref] [Pub Med] 42. Marmont, L. S. ; Rich, J. D. ; Whitney, J. C. ; Whitﬁeld, G. B. ; Almblad, H. ; Robinson, H. ; Parsek, M. R. ; Harrison, J. J. ; Howell, P. L. Oligomeric lipoprotein Pel C guides Pel polysaccharide export across the outer membrane of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 2017 ,114, 2892–2897. [Cross Ref] [Pub Med] 43. Marmont, L. S. ; Whitﬁeld, G. B. ; Rich, J. D. ; Yip, P. ; Giesbrecht, L. B. ; Stremick, C. A. ; Whitney, J. C. ; Parsek, M. R. ; Harrison, J. J. ; Howell, P
SHAP values, indicating Na Cl impact of the feature on the response, indicate that K,HPO4 the top five of the components are the most important (SHAP values for other components are K2SO4 much lower). Na Cl concentration in particular has Fe SO4 the highest impact on the predicted production. High SHAP values indicate high impact in increas- NH4CI ing response, whereas low SHAP values indicate high impact in decreasing response. Colors indicate (NH4) M0-024 High the value of the feature for the corresponding SHAP value. Hence high values of Na Cl concentration Cu SO4 Low produce high values of flaviolin titer, whereas high e Zn SO4 values of K2SO4 produce low values of flaviolin titer. Similar SHAP analyses for campaigns 2 and 3 can be Co Cl2 found in Figs. S8 and S9. SHAP values are in units of the response (Abs34o, Fig. 2). Mg Cl2 H3BO3 Mn SO4 -0. 15 -0. 10 -0. 05 0. 00 0. 05 0. 10 SHAPvalue (impact on model output) which compares the model output when a given feature is included or is the opposite trend to what we saw in C2 and C3 (Fig. 7, S8, S9). Similarly, excluded (i. e. , setting its value to the average of all observations). This K2HPO4 showed positive impact in the higher concentrations explored in process is performed for all possible features and feature combinations, with C1, while in C2 the highest importance was observed in a “goldilocks region" the final SHAP value being the sum of all individual feature contributions. within the explored concentrations, and in C3 it showed a much smaller Surprisingly, the salt Na Cl emerged as the most critical feature overall importance. These apparent incongruencies likely resulted from the active infuencing flaviolin production (Fig. 7, S8, S9). Na Cl ranked frst in feature learning algorithm exploring different parts of the phase space, changing the importance for campaigns C1 and C2, and second for C3 (with glucose average explored concentration of each component, which is used to cal- being the most important, as expected). In all three campaigns, the best- culate a positive or negative effect (SHAP value) for each observation. In performing media contained 8-9. 2 times the concentration in the starting addition, given that the concentration of KHPO4 was significantly smaller media (400-460 m M Na Cl, Fig. S6). The consistency between the final in the media providing the highest process yield, it seems likely that the results of three independent campaigns (Fig. 5), the feature importance phosphate demands in low glucose conditions are significantly diminished analysis (Fig. 7), and the distinct effect of Na Cl on flaviolin production due to lower growth. (Fig. 6B) underscore the importance of Na Cl for increased flaviolin pro- Certain components were only significant in some campaigns. For duction. Similar, but much smaller, increases in titer by Na Cl addition have example, K2SO4 was very important in C1, H3BO3 only in C2, NH4Cl in C1 been reported in other organisms and for diverse products. For example, and C2, and Mg Cl in C2 and C3. This variabilityis again due to the different Na Cl has been shown to improve growth as well as isoprenol production in trajectories the algorithm explored in the phase space. The remaining E. coli in the presence of ionic liquids5°. Increased salinity (120 m M Na Cl) components showed minimal importance throughout all three campaigns, also improved bioinsecticide production by Baccilus thurigiensis combined indicating that they are either unnecessary or required only in minimal with heat-shock. Squalene acumulation in the marine protist Thraus- concentrations, without adverse effects at higher levels. tochytrium sp. peaked at a Na Cl concentration of 85 m M58. Poly- Conventional wisdom based on mass-action kinetics (i. e. , the need to hydroxyalkanoate production was boosted in Na Cl concentrations of up to maximize the Ac Co A pool) and previous transcriptomics analyses is at odds 154 m M in Cuprividus necator. 9. Lastly, in activated sludge microbial with the result of high flaviolin production under high salinity conditions. communities, high Na Cl was shown to increase protease activity and Previous transcriptomics have shown that high salinity concentrations decrease glucosidase activity, while reducing the microbial diversity in the significantly affect the central carbon metabolism in Pseudomonas species. process°. However, most of these have been ad hoc observations rather than In these transcriptomics studies the following was observed: flaggela-related the product of a systematic study as we do here. When a systematic proteins were down-regulated, indicating a tendency to generate a biofilm in approach was followed, in the case of squalene production, Na Cl and glu- order to respond to osmotic stress; N-acetylglutamylglutamine amide cose were found as the most important drivers of production increase58. (NAGGN) biosynthesis was upregulated, as this metabolite is one of the However, this was a marine protist, for which the relevance of Na Cl is less most prominent osmoprotectants; membrane composition was changed by surprising, and only three media components were tested. Even in this case, overexpression of cardiolipin; and the expression of siderophores was the optimal Na Cl concentration was not nearly as extreme as the one found upregulated as iron-carrying proteins are used to combat Reactive Oxygen in this study (400-460 m M Na Cl) for the putative biomanufacturing host P. Species (ROS) stress (a common side-effect of osmotic stress)1. Similar putida. Indeed, these levels are comparable with those of seawater results were found in P. aeruginosa, where NAGGN biosynthesis knockouts (600 m M), and higher than the concentration used in medium for marine lost their ability to grow in Na Cl concentrations of 500 m M, but this phe- microalgae (308 m M Na Cl), prompting the consideration of production notype was rescued by adding betaine in the growth media. However, environments as very different from growth environments. cardiolipin requires glutamine and G3P to be synthesized, and NAGGN In all three campaigns, K2HPO4 and Fe SO4 were in the top five most requires Ac Co A and Glutamine. Glutamine consumption would pull car- influential components for high flaviolin production. Interestingly, Fe SO4 bon away from the production of flaviolin, which requires malonyl-Co A, showed negative impact for most of its highest concentrations in C1, which and similar effects would be expected by pulling carbon from G3P and Communications Biologyl(2025)8:630 7 [URL] Article FEasy Fpiff （人） 1. 00 1. 0 C 0. 75 0. 8 0. 50 0. 0 0. 25 0. 6 0. 4 0. 4 0. 00 0. 2 0. 25 0. 0 0. 2 ART_DE GPCAM 0. 4 GPCAM GPCAM JMP MP 10 10 Numberofcycles Numberofcycles Numberofcycles Fig. 8 \| ART outperforms other state-of-the-art algorithms (JMP and gp CAM). 10 DBTL cycles. Each process was run ten different times, and the lines and shaded We used ART, JMP, gp CAM to guide three corresponding simulated active learning areas represent the mean and standard deviation of the highest production for each processes where the 15 input variables (media designs) and responses (flaviolin pro- cycle. Individual traces for each run are shown in Fig. S10. Y represents the maximum duction) were used to recommend the next set of media designs. Response was production at each cycle normalized by the true optimum of each function. We also simulated through three different functions that present different levels of difficulty to tested a new recommendation algorithm for ART that improves on its original parallel being “learnt These functions of increasing diffculty are: A FEasy = ≥ (x; - 5)² + tempering approach (ART_DE) ART and ART_DE reached the highest productions after 10 DBTL cycles, except in the case of FEasy, where the difference with the best algorithm (JMP) is minimal. starting media designs were the same for all algorithms and each process was run for Ac Co A. Hence, one would expect the production of flaviolin to decrease, and very slowly. For the diffcult case, JMP's performance improved, but was rather than increase under high-salinity conditions, because carbon is being not able to reach better responses than gp CAM or ART. As previously, in pulled away from the production of the precursors to flaviolin. This high- this case gp CAM only saw a very slow increase in response as more DBTL lights how utiliing a purely data-driven approach can produce results and cycles accrued. Since JMP uses a quadratic approximation, when functions insights that are not obtainable through standard metabolic engineering deviate from that form its performance is limited. On the other hand, approaches. gaussian processes are able to handle functions of arbitrary form, allowing for higher versatility and hence outperforming JMP in the medium and ART outperforms other state-of-the-art approaches for guiding difficult cases. Lastly, ART uses an ensemble model, which includes a the optimization process gaussian process among other algorithms
1% for MTW and 98. 8% for PLS25, PLS50, and PLS100, resulting in a permeate FNU 1. 3. 2. 2. Nanoﬁltration The results of the NF performance experiments using the underground membrane pilot plant are shown in Figure 8 as a function of the feed solution and pressure at an overﬂow velocity of 1. 1 m s1and a recovery rate of 80%. Since the temperature of the feed solution is not adjustable at the on-site pilot plant membrane system, the temperatures are shown as well. Minerals 2022 ,12, 46 9 of 12 Minerals 2022 , 12, x 9 of 13 However, despite the permeance decrease, th e permeate quality remains constant as measured by the turbidity (FNU—Formazin Ne phelometric Units) with a reduction be- tween the feed and permeate by an average of 80. 1% for MTW and ≥98. 8% for PLS25, PLS50, and PLS100, resulting in a permeate FNU ≤ 1. 3. 2. 2. Nanofiltration The results of the NF performance experiments using the underground membrane pilot plant are shown in Figure 8 as a function of the feed solution and pressure at an overflow velocity of 1. 1 m s−1 and a recovery rate of 80%. Since the temperature of the feed solution is not adjustable at the on-site pilot plant membrane system, the temperatures are shown as well. Figure 8. NF permeance for MWT, PLS MTW, PLS25, and PLS50 depending on pressure and tempera- ture. Regarding nanofiltration, a decrease in permeance is observed as a result of increas- ing the system pressure. The ions present in the feed solution generate transport re- sistances due to their interaction with the membrane surface. These are increased with increasing pressure due to the reduction in thickness of the boundary layer and thus in- crease in the ion concentration directly abov e the membrane surface [27,28]. Furthermore, based on the conductivity, there is an increase in ion concentration from MTW to PLS- MTW/PLS25/PLS50 by a factor of about 4. 5, as shown in Table 4. The higher the pressure, the greater the influence of the osmotic pressure, which results in a reduction in perme- ance. This phenomenon is also observed and discussed by [29–33]. Moreover, at high pres- sures, the effects of concentration polarization, reversible and irreversible fouling, and diffusive transport back into the feed bulk becomes more important [34]. It can be also observed that the proportions of the solution composition of PLS MTW and PLS50 has no significant effect on permeance (cf. blue framed: PLS MTW–PLS25–PLS50 at 10 bar). The ef- fects resulting from the variation in solution composition are determined by the change in ion composition and depend on the qualit y of the microfiltration. ICP-MS analyses showed that the ion composition changes only slightly by adding PLS100 to PLS MTW; the main components and concentration ratios of, e. g. , Zn, Cu, Fe, Na, and S, remain relatively stable. Consequently, the constant in permeance for PLS MTW, PLS25, and PLS50 also re- flects the consistently high quality of the microfiltration as a pretreatment step for the nanofiltration stage. Otherwise, a permeance drop due to fouling effects would be ex- pected, especially for PLS5 0, because of the higher particulate feed-load. In addition to the permeance tests, the re tention of characteristic elements for PLS MTW, PLS25, and PLS50 at different pressures and a fixed overflow velocity of 1. 1 m s−1 was investigated. The results are shown comparativ ely with the results from the laboratory test (PLS DI) in Figure 9. Figure 8. NF permeance for MWT, PLS MTW , PLS25, and PLS50 depending on pressure and temperature. Regarding nanoﬁltration, a decrease in permeance is observed as a result of increasing the system pressure. The ions present in the feed solution generate transport resistances due to their interaction with the membrane surface. These are increased with increasing pressure due to the reduction in thickness of the boundary layer and thus increase in the ion concentration directly above the membrane surface [ 27,28]. Furthermore, based on the conductivity, there is an increase in ion concentration from MTW to PLS MTW /PLS25/PLS50 by a factor of about 4. 5, as shown in Table 4. The higher the pressure, the greater the inﬂuence of the osmotic pressure, which results in a reduction in permeance. This phe- nomenon is also observed and discussed by [ 29–33]. Moreover, at high pressures, the effects of concentration polarization, reversible and irreversible fouling, and diffusive transport back into the feed bulk becomes more important [ 34]. It can be also observed that the proportions of the solution composition of PLS MTW and PLS50 has no signiﬁcant effect on permeance (cf. blue framed: PLS MTW –PLS25–PLS50 at 10 bar). The effects resulting from the variation in solution composition are determined by the change in ion composition and depend on the quality of the microﬁltration. ICP-MS analyses showed that the ion composition changes only slightly by adding PLS100 to PLS MTW ; the main components and concentration ratios of, e. g. , Zn, Cu, Fe, Na, and S, remain relatively stable. Consequently, the constant in permeance for PLS MTW , PLS25, and PLS50 also reﬂects the consistently high quality of the microﬁltration as a pretreatment step for the nanoﬁltration stage. Otherwise, a permeance drop due to fouling effects would be expected, especially for PLS50, because of the higher particulate feed-load. In addition to the permeance tests, the retention of characteristic elements for PLS MTW , PLS25, and PLS50 at different pressures and a ﬁxed overﬂow velocity of 1. 1 m s1was investigated. The results are shown comparatively with the results from the laboratory test (PLS DI) in Figure 9. In the laboratory studies (PLS DI), an average retention of 28% was determined for Ge, whereas the multivalent cations Fe2+, Cu2+, Zn2+, and In3+remained almost 100% in the retentate. For the on-site application (PLS MTW ), a lower overall retention could be observed. Furthermore, an increased root-mean-square deviation is noticeable as well as a decreasing retention depending on the pressure. One reason for this effect is based on the test conﬁguration. The results of the PLS MTW came from a total of four test blocks with intermediary cleaning cycles with nanoﬁltrated MTW at low pressures and high overﬂow velocities. By observing the course of ion retention within each test block, a general decrease is notable. Cleaning between the test blocks achieves a certain increase in retention but does not compensate for the overall downward trend. Therefore, fouling and scaling on the membrane surface can be assumed, leading to shielding effects due to the increase in salt concentration on the membrane surface and to a decrease in membrane repulsion. The authors of [ 35] came to the same conclusion within concentration-dependent performance tests for NF membranes. To ensure a more constant process performance, cleaning cycles with citric acid and caustic soda were implemented between each test block for PLS25 and PLS50. The results shown in Figure 9 indicate a more constant retention behavior, especially Minerals 2022 ,12, 46 10 of 12 for the cations, with a slight upward trend due to increasing pressure. Furthermore, there is a positive inﬂuence on the selectivity with respect to indium and germanium, which was the highest at the lowest pressure (blue framed). The authors of [ 31] also observed an overall increase in ion retention with increasing pressure up to 15 bar using NF for copper AMD (acid mine drainage) ﬁltration. Above 15 bars, the retention decreased again, probably due to the increased driving force for ion ﬂow by an increase in concentration polarization. Similar results have been obtained in [34]. Minerals 2022 , 12, x 10 of 13 Figure 9. Pressure dependent ion retention for PLS DI, PLS MTW, PLS25, and PLS50 depending on pres- sure at 1. 1 m s−1 overflow velocity. In the laboratory studies (PLS DI), an average retention of 28% was determined for Ge, whereas the multivalent cations Fe2+, Cu2+, Zn2+, and In3+ remained almost 100% in the retentate. For the on-site application (PLS MTW), a lower overall retention could be ob- served. Furthermore, an increased root-mean-square deviation is noticeable as well as a decreasing retention depending on the pressure. One reason for this effect is based on the test configuration. The results of the PLS MTW came from a total of four test blocks with intermediary cleaning cycles with nanofiltra ted MTW at low pressures and high overflow velocities. By observing the course of ion rete ntion within each test block, a general de- crease is notable. Cleaning between the test bl ocks achieves a certain increase in retention but does not compensate for the overall down ward trend
combined uncertainty for the determination of bromine, As a general rule one randomly chosen sample from each cadmium, chromium, lead, mercury, and phosphorus exceed sampling campaign was subjected to further conditioning and the uncertainties for samples of geological origin (12-25%) by chemical analyses. In order to evaluate the uncertainties related sampling, repeated analyses were performed for nine Quantitative Metals Analyses. The quantitative analyses to sampling campaigns selected to cover a wide range of different of cadmium, chromium, lead, and mercury each included a samples. In addition, three samples were washed with distilled closed vessel microwave digestion followed by a specific water prior to their analysis to evaluate the effect of cross- chemical analysis. For every plastics sample three digestions contaminations (see SI Table 3). and analyses were performed. Laboratory Sample Conditioning. In a first step all Digestion followed a two-step procedure including addition metals except stranded copper wire and thin nonmagnetic of 5 m L of HNO3 65% and 3 m L H2O2 30% to 0. 3 g of the cables were removed by magnet and hand sorting from the dried and ground sample in the first step, and of 3 m L of HCl delivered sample (1-5 kg), and the resulting plastic and metal 37% in the second step. In parallel, for some of the first samples fractions each weighed. Depending on the sample, the sizes of an additional one-step digestion of O. 5 g of the dried and 629 dx. doi. org/10. 1021/es202518n IEnviron. Sci Technol. 2012,46,628635 Policy Analysis 10000 Category 1 Category 2 。 Ro HS(Pb, Hg. Cr(VI) 1000 。 Ro HS(Cd) wdd 。o 0. 1 cadmium mereury chromium I L lead chromium lead cadmium mercury 10000 Category 3 Category 4 Ro HS (Pb, Hg. Cr(VI) 1000 Ro HS (Cd) 。 0. 1 lead 1 cadmlum mercury chromlum L lesad — cedmlum mereury \| chromlum Figure 1. Concentration ranges of heavy metals in the mixed plastics fractions, allocated to each WEEE categories 1, 2, 3, and 4. (Cl: Large household appliances w/0 cooling appliances [5); C2: Small household appliances {2); C3: ICT equipment w/0 CRT- and flat screens [2); C4: Consumer equipment w/o CRT- and flat screens (1); M1: Small appliances w/0o CRT- and flat screens 7); M2: Small household appliances,tools, toys, leisure, and sport equipment [2); M3: ICT and consumer equipment w/o CRT- and flat screens [2]; P11: Cooling and freezing appliances (inside lining without drawers) {5); P12: Cooling and freezing appliances (all plastics, except foams) {6}; P22: Vacuum cleaners w/o hoses {1}; P23: M2 w/o vacuum cleaners {1); P24: Small appliances for high-temperature applications (e. g. , toasters, hair dryers, curlers) {1); P31: CRT monitors {5]; P32: Flat screens {5]; P33: Printers {3]; P41: CRT TVs {7}; P42: Flat screen monitors {1}). {: Number of sampling campaigns. ground sample with 2 m L of HNO3 65% and 6 m L HCl 37% For each of the analyzed samples, three measurements per (aqua regia) was performed. A comparison of the results from element were performed. According to,26 6 the extended, the application of the two digestion methods showed no combined uncertainty for the determination of cadmium, significant difference. chromium, lead and mercury amounts to 12-25%. For Cadmium was determined by inductively coupled plasma - chromium, the analysis with aqua regia in plastic material is known to result in a systematic underestimation of this mass spectrometry (ICP-MS) with an Agilent 7500ce, Octo- element. This could be demonstrated with a certified reference pole Reaction System. Calibration was performed with material (ERM EC 681 K). As a consequence, the chromium cadmium isotope 1ll at concentrations of 0, 1, 5, and 10 content was finally determined by XRF spectrometry (see μg/L. above), which delivers more accurate results despite higher Lead and chromium were determined by inductively coupled plasma-optical emission spectrometry (ICP-OES) with a uncertainties. 25 Quantitative Analysis of Brominated Flame Retard- Varian 73s-ES device. The lead concentrations were measured ants. Each 0. 5 g of the sorted, reduced, and ground samples at a wavelength of 200. 353 nm, and the calibration was were extracted with 100 m L of a mixture of cyclohexane and performed at concentrations of 0, 0. 2, 1. 0, 2. 0, and 10 mg/L. acetone (1:1) in a Soxhlet extractor for 16 h at a minimum. The chromium concentrations were measured at a wavelength Subsequently, the extracted compounds were derivatized for 60 of 205. 56 nm, and the calibration was performed at min at 70 °C after having added 40 μL of toluene and 20 μL of concentrations of 0, 0. 1, 0. 5, 1. 0, and 5. 0 mg/L. trimethylsilyl N,N-dimethylcarbamate (DMCTMS) or silyl-991 Mercury was determined by atomic fluorescence spectrom- (a mixture of N,Obis(trimethylsilyl)trifluoroacetamide and etry (AFS) at 253. 7 nm with an Analytik Jena Mercur device trimethylchlorosilane at a ratio of 99:1) to 40 μL of the extract. after reduction with an Sn Cl-solution and scavenging into a One to 2 μL of the extract each were injected on a splitless fluorescence cuvette. Calibration was performed at concen- injector BGB-1 10 m X 0. 25 mm X 0. 1 μm capillary column trations of o 0, 10, 50, and 100 ng/L. with a GC PAL autosampler. After separation in a Trace GC 630 dx. doi. org/10. 1021es202518n IEnviron. Sci Technol. 2012,46, 628635 Policy Analysis 100 Category 1 Category2 Ro HS (PBBs & PBDEs) 0. 1 TBBPA Penta BDE \| Octa BDE \| Deca BDE L TBBPA Penta BDE\|Oocta BDE Deca BDE 100 Category 3 Category 4 Ro HS (PBBs & PBDEs) TBBPA Penta BDE Octe BDE TBBPA Penta BDE \| Octa BDE \| Doca BDE Deca BDE Figure 2. Concentration ranges of specific BFRs in the mixed plastics fractions, allocated to each WEEE categories 1, 2, 3, and 4 (Cl: Large household appliances w/o cooling appliances {5); C2: Small household appliances {2}; C3: ICT equipment w/o CRT- and flat screens {2}; C4: Consumer equipment w/o CRT- and flat screens {1); M1: Small appliances w/o CRT- and flat screens {7}; M2: Small household appliances, tools, toys, leisure, and sport equipment (2); M3: ICT and consumer equipment w/o CRT- and flat screens (2); P11: Cooling and frezing appliances (inside lining without drawers) (S); P12: Cooling and freezing appliances (all plastics, except foams) (6); P22: Vacuum cleaners w/0 hoses (1); P23: M2 w/0 vacuum cleaners (1); P24: Small appliances for high-temperature applications (e. g, toasters, hair dryers, curlers) (1); P31: CRT monitors {(5]; P32: Flat screens {3); P33: Printers [3]; P41: CRT TVs (7]; P42: Flat screen monitors {1}). {: Number of sampling campaigns. Utra (make up gas N2 5. 0 30 m L/min, carrier gas H2), the The factors had been obtained from the analysis of different brominated flame retardants were detected with an ECD Ni63 commercially available technical mixtures and extensive round and quantified using a software. Calibration was done with the robin tests (unpublished data). Detection limits were pure compounds, namely BDE-47 (2,2'4,4'-Tetrabromdiphe- 0. 02 g/kg for BDE-47, BDE-99, BDE-183, BDE-197, nylether), BDE 99 (2,2'4,4',S-Pentabromdiphenylether), BDE- Deca BB, and TBBPA; 183 (2,2',3,4,4',S',6-Heptabromdiphenylether), BDE-197 0. 05 g/kg for DE-71 (Great Lakes, Pentas) and DE-79 (2,2'3,3'4,4'6'6-Octabromdiphenylether), BDE-209 (Deca- (Great Lakes, Octas); BDE), Deca BB (Decabrombiphenyl), HBCD (Hexabromocy- 0
47 48 49 98 50 51 52 99 53 54 55 100 56 57 58 59 60 ACS Paragon Plus Environment Page 5 of 29 ACS Sustainable Chemistry & Engineering 1 2 3 101 Continuous production of biolixiviant and testing of different dilution rates 4 5 6 102 The Sixfors. system was also used in a continuous stirred tank reactor (CSTR) mode for 7 9 103 production of biolixiviant. After initial reactor inoculation, the G. oxydans cultures were grown 10 11 104 under batch conditions for 15 hours to reach mid-log growth phase. Continuous culture was 12 13 105 initiated by feeding Pkm amended with glucose (40 g/L) at various dilution rates (hr'): 0. 05, 14 15 106 0. 16, 0. 25and 0. 38. Dissolved oxygen and p H were continuously monitored and samples (~1. 5 16 17 18 107 m L) were drawn from each culture periodically for measurement of optical density and organic 19 20 108 acid production. The CSTRs were operated for over 100 hours of continuous substrate feed and 21 22 109 biolixiviant production. 23 24 25 110 REE leaching 26 27 28 29 111 Spent FCC catalyst containing the key REE components cerium (Ce) and lanthanum (La) 30 31 112 was obtained from Valero (Houston, TX). The REE composition and characterization of the FCC 32 33 113 catalyst used in these experiments were reported previously;1* the total REE content of the FCC 34 35 36 114 catalyst was approximately 1. 5% by mass. 37 38 115 Leaching studies were conducted using filtered biolixiviant with FCC catalyst. Prior to 39 40 41 116 leaching, the solids were autoclaved three times to mitigate biological contamination. Leaching 42 43 117 tests were performed over a range of pulp densities from 1. 5 to 50% (solid to liquid mass ratios, 44 45 118 w/w), in 50 m L conical tubes incubated 24 hours at 30°C with shaking at 150 rpm. Control 46 47 48 119 treatments included FCC catalyst incubated with sterile Pkm medium without added glucose 49 50 51 120 To test the effects of G. oxydan cells on leaching, leaching studies were also performed 52 53 121 with biolixiviants that were not filtered to remove the bacterial cells prior to contact with the 54 55 56 122 FCC. These studies were conducted in the Sixfors. reactors operated under batch conditions as 57 58 59 60 ACS Paragon Plus Environment ACS Sustainable Chemistry & Engineering Page 6 of 29 2 3 123 described above except that FCC catalyst was added directly to the culture after 12 or 36 hours, 4 5 124 and the reactors were operated for an additional 24-48 hours. 6 7 8 125 Simulated heap leaching studies were also conducted to assess the effects of non-ideal 9 10 11 126 mixing that would be expected under those conditions. FCC catalyst was placed in a fritted glass 12 13 127 Bichner funnel and filtered biolixiviant was pumped on top of the catalyst bed and allowed to 14 15 128 percolate through the solids. The leachate was collected and pumped back onto the catalyst bed 16 17 18 129 to form a recycle loop which operated for 24 hours. The solid to liquid mass ratios tested were 19 20 130 1. 5% and 50%, where the ratios represent the mass of the solid compared to the total volume of 21 22 131 lixiviant applied, regardless of recycling. 23 24 25 132 26 27 28 133 Analyticalmethods 29 30 31 134 Organic acid analysis was performed by high-performance liquid chromatography as 32 33 34 135 described previously. 18 Gluconic acid (Sigma-Aldrich, Saint Louis, MO), 2-keto gluconic acid 35 36 136 (Sigma-Aldrich), 5-ketogluconic acid (Carbosynth, Berkshire, United Kingdom), and 2,5- 37 38 137 diketogluconic acid (provided by Masaaki Tazoe and Tatsuo Hoshino; NRL Pharma, Inc. , 39 40 41 138 Kawasaki, Japan) were used as standards. 42 43 44 139 REE concentrations were measured using ICP-MS. The ICP-MS instrument (Agilent 45 46 140 7900 with UHMI) was operated in accordance with manufacturer instructions. The filtered (0. 22 47 48 141 μm Millex-GP PES) samples and the commercial standard stock solutions were acidified with 49 50 51 142 ultrapure concentrated nitric acid to a concentration of 1% HNO3 (v/v). 52 53 54 143 Techno-Economic Analysis 55 56 57 58 59 60 ACS Paragon Plus Environment Page 7 of 29 ACS Sustainable Chemistry & Engineering 1 2 3 144 Raw Materialsand Utilities 4 5 6 145 The bioleaching plant was assumed to be capable of processing 18,838 metric tons of 7 8 146 FCC catalyst fedstock annually or 10% of the FCC catalyst used in the United States25, 26 and 9 10 11 147 located next to the existing FCC recovery infrastructure to minimize transportation and material 12 13 148 handling costs. 14 15 16 149 The bioleaching process consisted of two unit operations: a bioreactor to produce organic 17 18 19 150 acid (biolixiviant) which was then fed onto a leaching pile (the second unit operation) of FCC 20 21 151 catalyst. The bioreactor for organic acid production was based on a proposed succinic acid 22 23 152 production plant. 7 and included unit operations for nutrient medium sterilization and cooling and 24 25 26 153 aerobic batch fermentation (Figure S1). The downstream separation and purification unit 27 28 154 operations described for succinic acid were not included since purification of the organic acids 29 30 155 produced was not necessary for lixiviant production. The main utilities required for the 31 32 156 bioreactor operation included water, steam, and electricity. Water was used for the nutrient feed 33 34 35 157 cooler, the heat exchanger and for bioreactor cooling as well as to make up the nutrient feed, 36 37 158 while steam was required for sterilization of the nutrient feed and the bioreactor. It was assumed 38 39 159 that the FCC catalyst would not be sterilized. Electricity was estimated based on the energy 40 41 160 required for the operation of major equipment, such as bioreactor tank agitation, pumps for 42 43 44 161 transfer of nutrient feed to the bioreactor and transfer of biolixiviant from the bioreactor to the 45 46 162 leaching pile and air compressors for bioreactor aeration. 47 48 49 163 50 51 52 164 53 54 55 165 Fixed Capital Costs 56 57 58 59 60 ACS Paragon Plus Environment ACS Sustainable Chemistry & Engineering Page 8 of 29 2 3 166 Fixed capital costs include equipment purchase and installation costs, piping costs, 4 5 167 electrical equipment and material costs and costs of instrumentation and control. Major 6 7 8 168 equipment involved in the bioleaching process were the bioreactor, air compressor, nutrient feed 9 10 169 sterilizer, cooler, and heat exchanger. The size of each piece of required equipment was 11 12 170 estimated based on the target processing rate of spent FCCs as well as the required pulp density. 13 14 15 171 Costs including installation and capital were scaled to capacity and calculated as described 16 17 elsewhere. 27-29 Pulp densities of 1. 5, 18 and 50% (w/w) were considered for batch-produced 172 18 19 173 gluconic acid and a continuous production case with 5o% pulp density was also examined 20 21 22 174 23 24 25 175 Other Associated costs 26 27 28 176 Other costs included labor, maintenance, administration, marketing, and research and 29 30 31 177 development. These costs were divided into different categories: other direct costs (besides direct 32 33 178 costs from raw material, and utilities), indirect costs, and general costs. Silla (2003) provides the 34 35 36 179 empirical relations to estimate these costs (Table S1). Additional assumptions related to the plant 37 38 180 operation, debt financing, income tax and depreciation are listed in Table S2. 39 40 41 181 Revenue 42 43 44 182 There were assumed to be two sources of revenue from bioleaching of spent FCC 45 46 183 catalysts: 1) fee charged to oil refineries ($200/ton) for disposal of FCC catalyst as a hazardous 47 48 184 waste3° and 2) sales of REE leachate. The bioleaching output is an aqueous solution that contains 49 50 51 185 a mixture of REE products whose value is not well documented in literature as open market 52 53 186 prices are only available for >99% separated REE. An estimated price for mixed REE was 54 55 187 developed using a techno-economic study performed by SRK Consulting on Mountain Pass 56 57 58 59 60 ACS Paragon Plus Environment Page 9 of 29 ACS Sustainable Chemistry & Engineering 2 3 188 Mine and its processing facilities. ° From this study, the costs to leach REE from ore to produce 5 189 a mixed REE stream were approximately 40% of the total REE production cost. The remaining 6 7 8 190 60% of the costs were for processes such as solvent extraction to concentrate and separate 9 10 191 individual REE. Based on this, it was assumed that additional concentration and separation 11 12 192 processes would be required to purify the bioleached mixed REE stream and, to cover this cost, 13 14 193 the bioleached mixed REE stream value would be discounted to 40% of the market price. 15 16 17 18 194 Life Cycle Analysis 19 20 21 195 System boundary and functional unit 22 23 24 196 The scope of this LCA study is a gate-to-gate analysis of the bioleaching process, starting 25 26 197 with spent FCC catalyst and ending with a mixed aqueous REE stream
Overall, the PET films coated with GA/AMPs had good bility for water washing. Moreover, in a two-week period antibacterial bacterial inhibition efficiency against E. coli and S. aureus, with inhibi- experiment, the PET films coated with the GA/AMP aggregates can tion rates all reaching > 90 %. Combining the above results, it can be J. Fu et al. Colloids and Surfaces A: Physicochemical and Engineering Aspects 722 (2025）137292 (a) (b) 100 1. 4 +GA-G3 —GA-C12 1. 2 ←GA-C16 80 1. 0 009 0 60 0. 8 0. 6 40 GA-G3 20 —GA-C12 0. 2 ←GA-C16 0. 0 1. 5 0. 0 0. 5 1. 0 2. 0 2. 5 0. 0 0. 5 1. 0 1. 5 2. 0 2. 5 3. 0 Concentration (μg/cm²) Concentration (μg/cm²) (c) (d) 1. 8 +GA-G3 100 1. 5 GA-C12 —GA-C16 80 E 1. 2 uon 60 0. 9 40 20 <0. 3 GA-G3 GA-C12 0. 0 GA-C16 0. 0 0. 5 1. 0 1. 5 2. 0 2. 5 0. 0 0. 5 1. 0 1. 5 2. 0 2. 5 Concentration (μg/cm²) Concentration (μg/cm²) Fig. 7. Light absorbance (Abs) values of of (a) E. coliand (c) S. aureus dispersions treated by GA/AMPs-coated PET film. CFU reduction ratio (antibacterial efficiency) of (b)E. coli and (d) S. aureus treated by GA/AMPs coated PET film. retain > 85 % bacteriastatic efficienty, proving that the GA/AMP coat- 4. Conclusions ings can achieve long-lasting antibacterial effect. The superior antibac- terial performance of the GA/AMP coatings can be rationalized as In summary, three kinds of AMPs (G3, C12, and C16) have been follows. First, GA is a polyphenol molecule with multiple reactive chosen to composite with GA to construct antibacterial materials. By groups, which can provide strong adhesion on PET surface [23,27]. having a large number of phenolic hydroxyl groups and mussel protein- Second, the GA/AMP aggregates are insoluble, which offers superior like adhesion propertym GA can co-assemble with AMPs to form insol- resistance to water washing. Third, the GA/AMP aggregates can serve as uble aggregates through non-covalent interactions such as hydrogen reservoirs to release both GA and AMP molecules gradually. The two bonding, electrostatic interaction, and hydrophobic interaction. The species would work synergistically to inhibit bacterial growth via aggregates can be lyophilized into powder and disolved in 75 % ethanol different mechanisms. to configure GA/AMPs ethanol solution, which can further be sprayed or spin-coated on the surface of PET film to fabricate antibacterial coatings. 3. 6. GA/AMPs cytotoxicity assay The antibacterial coatings have an inhibition rate of approximately 90 % against E. coli and S. aureus. After two days of washing, the antibacterial Ideal antibacterial agents should not only exert high-efficient and materials are still stably adsorbed on the PET surface, and the antibac- broad-spectrum antibacterial effects, but also avoid affecting normal terial performance is well retained. Moreover, such antibacterial coat- mammalian cell and causing skin irritation. Herein, MTT method was ings are highly biocompatible for Hep G-2 and CHO cells. Therefore, this employed to determine the cytotoxicity of the GA/AMP materials. study successfully demonstrates the design and efficacy of non-covalent Cancer cell of Hep G-2 and normal cell of CHO were chosen as the model GA/AMP co-assembled coatings, which exhibit robust antibacterial ac- cells to determine the cell viability. The concentrations of GA/AMPs tivity, exceptional wash resistance, and promising biocompatibility. The coated on the surface of PET film was set to 1. 0 μg/cm, 1. 5 μg/cm, integration of gallic acid's adhesive polyphenol chemistry with AMPs' 2. 0 μg/cm², 2. 5 μg/cm², 3. 0 μg/cm², 3. 5 μg/cm², 4. 0 μg/cm², membrane-disruptive properties offers a scalable, eco-friendly strategy and 4. 5 μg/cm2. Cell survival rates of the two kinds of cells are shown in for durable antimicrobial surfaces in medical and food packaging Fig. 9. It can be observed that the survival rate of Hep G-2 cells treated applications. with GA/G3, GA/C12, and GA/C16 decreased from about 92. 18 %, However, while the GA/AMPs co-assembly system demonstrates 94. 17 %, and 93. 56-65. 61 %, 76. 59 %, and 73. 96 % with the increase improved wash resistance and biocompatibility over conventional of the concentrations of GA/AMPs. The survival rate of CHO cells coatings, its applicability remains constrained by substrate specificity decreased from about 94. 36 %, 95. 69 %, 95. 08-71. 87 %, 79. 13 %, (tested solely on PET) and inherent material vulnerabilities, including 76. 99 %. Overall, the cell survival rate of both types of cells was above enzymatic degradation of AMPs, oxidative instability of polyphenols, 70 % for GA/AMPs in this concentration range. This result indicates that and challenges for more complexed rea-world applications. Future GA/AMPs are less toxic to cells, highly biocompatible and safer for food research must prioritize three interconnected objectives: (1) broadening packaging. substrate compatibility through adhesion studies on metals, ceramics, and textiles; (2) enhancing functional durability by engineering J. Fu et al. Colloids and Surfaces A:Physicochemical and Engineering Aspects 722(2025) 137292 (a) Control GA G3 C12 C16 GA-G3GA-C12GA-C16 Before washing After washing (b) Control GA G3 C12 C16 GA-G3 GA-C12 GA-C16 Before washing After washing 0 (c) (d) (%) % 60 二 20 Beforewashin Afterwashing GA Fig. 8. Pictures of (a) E. coli and (b) S. aureus plates after treatment by antibacterial d PETfilms either before and after waterwashingfor two days. The uncoated PET film was used as a control. Quantification of the CFU reduction rates in the cases of either (c) E. coli or (d) S. aureus. Table 2 The antibacterial activity as well as the percentage retention of the PET film coated by each material after before and water washing. Antibacterial activity towards E. coli Antibacterial activity towards S. 0 Before washing After washing Percenta retention Before washing After washing Per retention GA 68. 3 % 0 % 0 % 68. 4 % 0% 0 % G3 78. 6 % 0 % 0 % 69. 5 % 0% 0 % C12 61. 4 % 0 % 0 % 54. 2 % 0 % 0 % C16 71. 0 % 0 % 0 % 60. 1 % 10. 2 % 17. 0 % GA/G3 89. 7 % 80. 3 % 89. 5 % 84. 7 % 87. 7 % 103. 5 % GA/C12 81. 4 % 87. 3 % 107. 2 % 91. 0 % 90. 2 % 99. 1 % GA/C16 80. 7 % 78. 7 % 97. 5 % 92. 1 % 91. 2 % 99. 0 % (a) (b) (c) 100 Hep G2cell Hep G2 cell 100 Hep G2cell CHOcell 100 CHO cell CHO cell (%) 80 60 60 A. 40 20 20 15 20 25 30 35 40 50 1. 01. 52. 02. 5 3. 03. 54. 04. 5 1. 01. 5 2. 0 2. 5 3. 0 3. 5 4. 0 4. 5 Coating dosage (μg/cm²) Coating dosage (mg/cm²) Coating dosage (μg/cm) Fig. 9. Cell viability of Hep G-2 and CHO cells on the PET films coated by (a) GA/G3, (b) GA/C12, and (c) GA/C16 at different dosages. J. Fu et al. Collids and Surfaces A: Physicochemical and Engineering Aspects 722 (2025） 137292 enzymatic/oxidative resistance and environmental adaptability; and (3) fabrics coated by cationic fluorinated polymers, ACS Appl. Mater. Interfaces 10 validating real-world efficacy through biofilm-targeted assays, poly- (2018) 6124-6136. [11] R. Shi, H. Geng, M. Gong, J. Ye, C. Wu, X. Hu, L. Zhang, Long-acting and broad- microbial models, and in vivo assessments. Furthermore, comprehensive spectrum antimicrobial electrospun poly (e-caprolactone)/gelatin micro/ safety evaluations—particularly long-term toxicity profiling, tissue- nanofibers for wound dressing, J. Colloid Interface Sci. 509 (2018) 275-284. specific response analyses, and sub-lethal effects-must align with reg- [12] R. Zhao, W. Kong, M. Sun, Y. Yang, W. Liu, M. Lv, S
X, Huo, X, 2008. Blood lead and cadmium levels and relevant factors among Waste Management World, 2010. Indian Government Proposes e-Waste Producer children from an e-waste recycling town in China. Environmental Research 108, Responsibility. Waste Management World. 15-20
APPLIED ANDENVIRONMENTAL MICROBIOLOGY, July1976,p. 102-107 Copyright ©1976American Societyfor Microbiology Vol. 32,No. 1 Printed in U. S. A. Influence of Organic Solvents on Chalcopyrite Oxidation Abilityof Thiobacillus ferrooxidans ARPAD E. TORMA* ANDIRWIN J. ITZKOVITCH Mineral Research Center,Quebec Department of Natural Resources Quebec,Quebec,Canada Gl P3W8,and Ontario Research Foundation, Mississauga, Ontario, Canada L5K1B3 Received forpublication 9February 1976 Ithasbeenshownthatorganicsolvents usedprimarily fortheextraction of metalsfromaqueous leachliquorsdecrease boththesurface tension ofthe aqueous phaseandthechalcopyrite oxidation abilityof Thiobacillus ferrooxi- dans. Forthereagents andmodifiers investigated, theorderofinhibition was foundtobe LIX70<LIX73<LIX71<LIX64N<LIX65N<TBP - isodecanol -nonylphenol <LIX63<<<D2EHPA -Kelex100<Kelex120 <<<Alamine 336-Alamine 308-Alamine 310<Alamine 304<Adogen 381 -Aliquat 336<Adogen 364. Toavoidlimitation inbacterial activity, organic mattershouldberemoved fromtherecycling liquorpriortoleaching. Biohydrometallurgical treatment hasbeen practiced extensively formetalrecovery from low-grade sulfide-bearing materials (10). The chemolithotrophic bacterium Thiobacillus fer- rooxidans, whichisresponsible formetaldisso- lution,derivesthenecessary energyforitslife processes fromoxidation offerrousiron(14)and reduced-valence inorganic sulfurcompounds (13)andutilizescarbondioxideforgrowth(23) whencultured onmetalsulfides. Previous stud- ies(1,19,20,22,23;A. E. Torma, Canadian patentno. 960,463,7January 1975)suggested theapplicability ofthistechnique fortreating high-grade sulfide concentrates. Recent re- views(3,8,12,21,24-26)summarize thedata available intheliterature. Dissolved metalscanberecovered fromleach solutions bycementation, chemical precipita- tion,ionexchange, etc. (5). Arecenttrendhas beentousesolventextraction formetalsepara- tionandrecovery (7). Inthislatterprocess, the leachsolution ismixedwithanorganicsolvent, thephasesareseparated, theaqueous phaseis recycled toleaching, andmetalisrecovered fromtheorganic solvent. Therecycled leach liquorwillcontaindifferent amounts oforganic matterdepending onthesolubility ofthesol- ventused. Thesubjectofthispaperishowbacterial activity isaffected bydissolved organic com- poundsusedinsolventextraction ofmetals. MATERIALS ANDMETHODS Microorganism. Thestrainof T. ferrooxidans usedinthisstudywasoriginally isolated by Torma (17)fromacidminewatersinnorthern Quebec. It wasroutinely maintained inourlaboratories onamodified Silverman and Lundgren (15)nutrient me- diuminwhichachalcopyrite concentrate replaced ferroussulfateastheenergysource. Substrate. Thechalcopyrite concentrate wascom- posedofthefollowing majorconstituents (weight/ weight): 15. 73%copper,37. 76%iron,30. 12%sulfur, and0. 88%zinc;italsocontained theminerals chal- copyrite, pyrite,pyrrhotite, quartz,andblende. Solvents. Theorganicsolvents usedinthisstudy areshownin Table1. Cultivation. Cellswerecultured inleachsuspen- sionscontaining 6%(wt/vol) chalcopyrite concen- trate,10%(vol/vol) inoculum of T. ferrooxidans, and 30litersof9Kbasalsaltsmedium (15). Athermo- statically controlled, stirredtankapparatus, the working principles ofwhichweredescribed previ- ously(23),wasused. Theseexperiments werecar- riedoutatp H2. 3and35°Candwithairenrichment to0. 2%CO2foraeration. Thiscarbondioxide con- centration hasbeenreported tobeoptimal forthe growthof T. ferrooxidans (23). Whentheearlysta- tionaryphasewasreached, thep Hdecreased to1. 9. Aportionofleachsuspension wasthentransferred intoanewmedium tomaintain thestockculture, andbacteria wereharvested fromtheremaining part. Harvesting. Bacterial cellswerecollected from thedecanted leachsolutions bycentrifugation (model RC2-B; high-speed, large-capacity motor [13,000rpm,27,300 xg];I. Sorvall Inc. ,Newton,Conn. ). Thesolutions werecentrifuged at5,000rpm, andthesupernatant fluidcontaining thebacteria wasremoved carefully soasnottodisturbthesedi- ment. Thisfluidwasthencentrifuged at18,000rpm. Thepackedcellswereresuspended inthebasalsalts medium inaproportion producing a10%(wetwt/ vol)suspension andstoredforaweekat4°Cwithout anymeasurable lossoftheirchalcopyrite oxidation ability. Protein determination. Cellular proteinwaslib- eratedbyalkaline digestion (0. 1NNa OH)ofthe Downloaded from [URL] on 26 July 2025 by 2401:4900:7ce0:abd9:f523:2e06:6fac:73de. VOL. 32,1976 CHALCOPYRITE OXIDATION BYT. FERROOXIDANS 103 TABLE1. Organic solvents usedcommercially fortheextraction ofcopperanduranium SOLVENT STRUCTURE SUPPLIER LIX63 CH3(CH2)3 CH-C-CH-CH(CH2)3 CH3 GENERAL MILLS I CHEMICALS I. NC. C2H5NOHOHC2H5 Cg H19g HONOH LIX65N+LIX63(99:1) LIX70 LIX70C9H19 HONOH +LIX65N +LIX65N+LIX63GENERAL MILLS CHEMICALS INC. GENERAL MILLS CHEMICALS INC. IX63 C9H19 OHCHCH-CH2 OH C9H19 20VOL. %KELEX 100INNONYLPHENOLGENERAL MILLS CHEMICALS INC. GENERAL MILLSCHEMICALS INC. ASHLAND CHEMICAL CO. J. T. BAKER CHEMICALS ASHLAND CHEMICAL CO. C8H17 C8H17 N CSH17CS/Cgo MIXTURE +1%SECONDARY AMINE +02%PRIMARY AMINEGENERAL MILLS CHEMICALS INC. C8H17ZC8H17 N NCSH17ASHLAND CHEMICAL CO. C8/CIO MIXTURE CH3 /CH3 NCH(CH2)5 (CH2)5CH CH3 N CH3 (CH2)5 CH CH3/\CH3GENERAL MILLS CHEMICALS INC. LIX65N LIX64N LIX70 LIX71 LIX73 KELEX 100 NONYLPHENOL KELEX 120 ALAMINE 336 ADOGEN 364 ALAMINE 308 Downloaded from [URL] on 26 July 2025 by 2401:4900:7ce0:abd9:f523:2e06:6fac:73de. 104 TORMA ANDITZKOVITCH SOLVENT ADOGEN 381 ALAMINE 310 ALAMINE 304 Di(2-ETHYLHEXYL ) PHOSPHORIC ACID TRIBUTYLPHOSPHATETABLE 1-Continued STRUCTURE* CH3 ICH3 CH(CH2)5 (CH2)5CH CH3 N CH3 (CH25 CH CH3 CH3 CH3 CH3 CH(CH2)7 (CH2)7 CH / \ NCH3 N CH3 (CH2)7 CH CH3 CH3 C12H25 C12H25 N C12H25 C2H5 CH3(CH2)3 -CHCH2 -0O /POH CH3(CH2)3- CHCH2 0 C2H5 CH3(CH2)3 -O\ 0 /O(CH2)3CH3CH3(CH2)3-OSUPPLIER ASHLAND CHEMICAL CO. GENERAL MILLS CHEMICALS INC. GENERAL MILLS CHEMICALS INC. UNION CARBIDE CORP BDHCHEMICALS INC. CANADIAN INDUSTRIES LTD
98 This radioactivity of these elements may limit their utility for specific, uptake and trafficking machinery was discovered in several essential biological functions, metal-reducing bacteria such as organisms roughly contemporaneously98,100,102,103 3andwe Shewanella can use uranium(v) as an (extracellular) electron reported direct evidence in M. extorquens for the existence of a secreted chelator selective for the lighter Ln" ions, a lanthanide quantities of uranium. 113 Other bacteria, such as Caulobacter MNJ crescentus, exhibit pathways linked to uranium resistance,114 isms of uptake likely exist in other Ln-utilizing bacteria. 92105 and bacteria isolated from Pu-contaminated waste sites have Lan M was adapted into a fluorescent, Forster resonance adapted to the presence of actinides and can contribute to energy transfer (FRET)-based sensor for REEs which conserved un the useful metal-binding affinity and REE-selectivity observed However, now that significant quantities of other actinides b in the wild-type protein, illustrating how biological strategies are present in the environment from anthropogenic sources, it for REE coordination can be directly translated into useful is likely that a substantial bioinorganic chemistry of An ions industrial and scientific tools (see also Section 5. 1). 98 This exists. The coordination chemistry of Ln"l ions is similar to MOd sensor allowed demonstration that the same Ln" ions that trivalent An ions, such as the minor actinides, with Anl support robust Ln-dependent growth of M. extorquens (La-Nd) complexes typically possessing slightly higher affinities than also are selectively taken up into the cytosol. Because all of the previously identified proteins involved in Ln utilization were Cm" are most similar to Nd", and Bk" and Cfl most similar 0 periplasmic, it was unknown at the time what Ln-dependent to Sm". 10 It is almost certain that these actinides would bind 5 functions exist in the cytosol, although they presumably would tightly to Ln-binding proteins like lanmodulin, enzymes like include other enzymes, regulatory systems, and/or metal sto- methanol dehydrogenase, and lanthanophores. In addition, rage. Indeed, recent work has also shown that, like many other because Nd"l is used by most of the Ln-utilizing bacteria Ss studied so far, it is plausible, and even likely, that Am"l and lanthanides are also accumulated and stored in phosphate- Cm"l ions could be taken up by the organisms and activate containing granules in the cytosol. 03 The potential application PQQ-dependent alcohol dehydrogenases, and possibly other of Ln-utilizing organisms;1 Ln uptake, trafficking, and storage yet-to-be discovered proteins in the lanthanome, in vivo. pathways inserted into other heterologous organisms; and proteins It may even be possible that tetravalent Ans (Th"", Pu") can or small molecules used in cell-free systems50 for biometallurgy will be used by these systems, given links between the speciation of be discussed in more detail in Sections 4 and 6. these ions and that of Fe"l and Ca in humans,7 as well as the The bacteria presently known to utilize REEs for specific already clear analogies between the coordination chemistry purposes use only LREEs, with the ability to use various Ln of Fell and Ca and REE uptake and trafficking pathways in falling off at different rates across the series (e. g. , La and Ce in bacteria. 50 Bradyrhizobium,46 La-Nd in M. extorquens,98,100,108 and La-Gd in M. fumariolicum. 49) The molecular origin of this preference for LREEs appears to derive from a combination of LREE- 4. E Biological methods for extraction selective uptake mechanisms (secreted lanthanophores),98,100 and separation of f-block elements redox matching between the Ln"-PQQ cofactor in Xox F and its Driven by their high positive charge, REEs and actinides form potentially other as yet uncharacterized pathways. Organism- stable complexes with many anionic compounds commonly dependent differences between these factors may contribute to 1 found in biological systems (phosphates, carboxylates, hydroxides), differences in the specific lanthanides that support growth. as well as widespread biopolymers (chitin, cellulose, alginate). However, there are no reported examples to date of organisms These interactions have been explored for decades in an attempt that can efficiently utilize Ln past Gd, and even those that can to extract and/or separate these technologically valuable elements. use Sm, Eu, and Gd do so poorly. 49,89 In this section, we discuss the variety of ways that cells and Chem. Soc. Rev This journal is @ The Royal Society of Chemistry 2020 View Article Online Chem Soc Rev Review Article biomolecules can be used to extract these metals, beginning with (Table 1). 124,125 Optimal conditions are generally mild, with whole-cell approaches and transitioning to molecular approaches. We do not provide an exhaustive enumeration of all examples of formation of insoluble metal hydroxides, while low p Hs may each approach; we refer the reader to several reviews of various protonate ligands, limiting binding. Intermediate p Hs will protonate some of the potential cell ligands, offering some and plantsl19 for more details. Instead, we provide representative selectivity in metal binding. 126 Desorption, or removal of the examples and the insight that they give into the central challenge of metal from biomass, can be accomplished through the addi- achieving useful selectivity between these metals and against other tion of excess ligand, such as citrate or ethylenediamine tetra- common and strongly interacting metal ions. acetic acid (EDTA) (Fig. 4), to the mixture, or by lowering p H. Conditions such as p H, temperature, pulp density, biomass 4. 1. Whole cell biosorption concentration, and incubation time can all be tuned to opti- 0 Metal ions can be present in an environment in soluble or mize adsorption efficiency and improve selectivity during insoluble form. Cells may interact with metals via direct 1/01 adsorption (biosorption), internalization, or mobilization with addressed in the literature when assessing new adsorbents. the help of lixiviants (liquids containing molecules capable of Many different biological samples, from algae to grapefruit liberating metals from a solid feedstock). Because biosorption peels, have been examined for their potential utility in bio- takes place on the cell exterior, it is a particularly attractive mechanism for metal extraction because rapid mass transfer from low-grade feedstocks, remediate industrial waste, or liberate is observed, within hours. Cell surfaces are ideal for metal metals from solid e-wastes such as spent phosphors. 6,128,147 Most f adsorption because of their large surface area per unit organisms display a net negative charge to their external environ- weight. 117,122 However, adsorption capacities of unmodified ment, making both whole-cell and membranous extracts useful biomass are typically low (these values on average erange for biosorption of metal ions. Although typically non-specific, un between 10-20 mg g-1 dry weight, although some numbers as these ubiquitous interactions may be useful as a first pass in b high as 100 mg g bioremediation of contaminated wastes or concentration of to the heterogeneity of the cell surface ligands. Nevertheless, valuable metals from low-grade feedstocks. 143 Biosorbents confer functionalization can increase both of these characteristics a number of intrinsic advantages, such as compatibility with mild Table 1 Representative examples of biological methods for REE and uranyl extraction Adsorption capacity Name (reference) Metals (mg g p H Comments 5 0 S. cerevisiae123,127 Ln ~16-40 4 Limited, unselective cation adsorption; reuse not addressed Phosphorylated S. cerevisiae127 Ln/Y ～100/59 4 Selective adsorption of Lns at p H 2, reuse not addressed S. cerevisiae rim20123 La 70 4 Selectivity and reuse not addressed Chitosan' Eu 3 Selectivity and reuse not addressed Phosphorylated graphene oxide-chitosan U 780 Selective vs. divalent and trivalent cations; desorption requires concentrated acid; reuse not addressed Phosphorylated chitosan U 980 5 Enhanced selectivity vs. divalent and trivalent cations; carboxymethyl cellulose130 desorption and reuse not addressed Eu 120 3-7 Selectivity and reuse not addressed Amidoxime-functionalized magnetic Eu/U 380/360 4-5 Limited selectivity vs. heavy metals; efficient for ≥5 cycles chitosan132 Cellulose133 Er 47 5 Selectivity not addressed; loss of ~ 7% efficiency over 5 cycles Thiourea-functionalized celulose133,134 Nd/Eu 27/73 N/A Calcium alginate gel beads135 Nd 200 3. 5 Selective vs. most common cations (RNd/m > 20) except Fe, Cr", A, Cu"; stable for 8 cycles Sodium /-PGA136 Nd 310 3 Unselective vs. Cu"; reusability not addressed Calcium alginate PGA hybrid ge1135 Nd 240 3. 5 Highly selective vs. most common cations (RNd/m > 50) except Fe, C, Al, Cu"; stable for 8 cycles Caulobacter crescentus LBT137 Ln 9 6 Preferential binding of HREEs; stable for 3 cycles; requires addition of Cal Curli-LBT138 Ln 47 6-7 Mildly selective for HREEs; loss of 50% overall sorption in presence of mixed metals. Effective after 3 cycles
05), revealed the suitability of the models. Consequently, the fitted RSM model showed high coefficients of determination (R 2 = 0. 959/0. 981 for Zn/Mn) between the variables and the responses; this indicated that the model can pr edict the yield of metal extraction with high accuracy under various conditions for the spent ZMBs bioleaching process. The observed and predicted Zn/Mn concentration of metal removal from the spent ZMBs under 29 different extraction conditions were shown in Table 2. There were also significant linear relationships between the predicted Zn/Mn concentration by the second order polynomial models and the observed Zn/Mn concentration with high coefficients of determination (R 2 = 0. 959/0. 984) for Eq. (3. 3) and Eq. (3. 4), indicating that the models can approximate the relationship between the variables and responses accurately under the experimental design conditions. The plots of the predicted versus observed values for Zn/Mn dissolution concentration was shown in Fig. 1, also suggesting the above relationships. Predicted Zn (g L -1) = 0. 312 + 0. 959 × Observed Zn (R2 = 0. 959) (3. 3) Predicted Mn (g L-1) = 0. 193 + 0. 98 2 × Observed Mn (R2 = 0. 9 8 4 ) ( 3. 4 ) To confirm the validity and reliability of the second order polynomial equations obtained in RSM, two additional confirmation optimum experiments runs (i. e. SC, p H, T, PD was 28 g L-1, 1. 9, 33 °C, 9. 7% for Zn and 29 g L-1, 1. 8, 36. 7 °C, 8% for Mn) were carried out in triplicate. The dissolution concentration of metal was 10. 09 ± 0. 71 g L-1 (the extraction efficiency of 50. 01 ± 3. 52%) for Zn and 12. 36 ± 0. 55 g L-1 (the extraction This article is protected by copyright. All rights reserved efficiency of 50. 66 ± 2. 25%) for Mn after 9 days of bioleaching respectively. In addition, the relative error between the measured data of the confirmation experiments and the calculated results of the models were 4. 7% fo r Zn and 3. 3% for Mn respectively. Since the value predicted by the model was within the 95% confidence interval, this can be taken as the confirmation of the suitability of the regression model for predictive purposes. 1,16 Therefore, the RSM approach and CCD developed in this study provides reliable predictive data for the removal Zn/Mn analysis of the spent ZMBs bioleaching process. In addition, in our previous single factor optimum bioleaching experiments, the extraction efficiency of Zn dropped from 100% at 1% of pulp density to 29. 9% at 8% of pulp density and Mn from 94% to only 2. 5% under the following conditions: T of 30°C, the initial p H at 1. 0 (without p H adjustment) and SC of 4. 0g L-1. 19 The confirmation experiments of CCD of RSM, by contrast, produced the extraction efficiency of 50% for Zn and Mn, which were 2 and 20 times higher than that of previous bioleaching without the exogenous-acid p H adjustment, respectively. An assessment of the importance factor of the exogenous-acid p H adjustment is given in s ubsection ‘The main factors in bioleaching process’ below. The interaction amongst factors in bioleaching process The calculated values of the regression coefficients of Zn/Mn were presented in Table 4. The results of correlation showed: the linear and quadratic terms are significant, suggesting that the second order polynomial models were fundamental to represent the data. The statistical analysis of the interaction term s at 5% significance level showed that the quadratic terms except SC were the extremely significant level. In addition, there were This article is protected by copyright. All rights reserved significant interactions between p H with T for Zn and between T with both p H and PD for Mn. This revealed that the optimum level p H depends on the level of T for Zn and the level of PD besides T for Mn in the spent ZMBs bioleaching process. Furthermore, the results presented in Table 4 indicated that the interaction between SC with the other three factors was statistically insignificant; as the result, the optimum level of SC in the spent ZMBs bioleaching process did not depend on the level of p H, T and PD controlled. In the case where interaction between factors is statistically significant, surface plots give more complete information regarding the effect of a factor on the response. 1 The 3-D response surface and 2-D contour plots expre ssing the dissolution concentration of Zn/Mn (0 levels of CCD in Table 1) were carried out using MINITAB Release 15. It was shown in Fig. 2a, 2b that as the p H decreased (from 2. 4 to 1. 8) in a range of optimum temperature for Mn dissolution concentration shifted to higher values (from 9. 8 to 10. 8 mg L-1). The surface plot presented in Fig. 2c, 2d showed that a statistically significant interaction between T and PD, and the effect of T on the dissolution concentration of Mn depended on the PD. An optimum range of temperature (in range of 35-37. 5°C) led to an increase value in Mn dissolution concentration for the bioleaching process at low PD; meanwhile, with an increase in the PD in a range of optimum temperature shifted to higher values. However, it can be seen in Fig. 2d that the dissolution concentration of Mn shifted quickly to lower values with an increase in the PD in a range of optimum temperature due to very high content of both metals and alkaline matter which were toxic to the bioleaching bacteria. 8,11,13,14 The surface plot presented in Fig. 3a, 3b showed that there was a statistically significant This article is protected by copyright. All rights reserved interaction between p H and T for Zn bioleaching process as well as for Mn. It can be seen in Fig. 3c that the dissolution concentration of Zn increased greatly in optimum range of temperature (in range of 1. 8-2. 0) and the pr edicted response values can reach the best response point within the range study. This suggested that p H control was more important than T control because Zn existed mainly in the form of weak acid soluble fraction (52%) in the raw batteries material. 9 Furthermore, a comparison of Fig. 3d and Fig. 2d showed that, in the spent ZMBs bioleaching process for Zn, PD control was not critical than T at high pulp densities. The main factors in bioleaching process Independent factor of values of regression coefficients calculated for Zn/Mn recovery during bioleaching of the spent ZMBs were given in Table 4. Both the P-value (linear or quadratic) of the exogenous-acid p H adjustment and temperature for Zn were 0. 000, which were the extremely significant level. This suggested that p H and T were the main factors control for greatly improving the performance of removal Zn from the spent ZMBs in bioleaching process. In the meantime, for the Mn bioleaching process, the minimum values for the linear and quadratic P-value were p H and PD, which were 0. 000/0. 000 and 0. 001/0. 004 respectively. This meant that p H and PD control were the main factors for removal Mn in bioleaching process. Based on these results ，it suggests that, for removal Zn and Mn from the spent ZMBs in bioleaching process at high pulp densities, p H control was the most important factor than the other three factors. The optimum level of p H, on the other words, plays a dominant role during bioleaching of spent ZMBs. Since, according to our previous study, 19 it also pointed out one of the precautions was to apply the periodical This article is protected by copyright. All rights reserved exogenous-acid adjustment of the bioleaching media technology, which can more effectively decline the death of the mixed bact eria coming from the toxicity of alkaline substances and sustain the activity of the strain in the whole of the spent ZMBs bioleaching process. Compared with the case without adjustment, the exogenous-acid adjustment increased extraction concentration of Mn from 9910 to 12410 mg L -1 at pulp density of 4% and it attained the maximum extraction efficiency of 89%. 19 Previous studies revealed that as pulp density increased from 1 to 2, 4 and 8% , the p H value of media (initial p H of 1. 0) increased respectively from 1. 8 to 4. 8, 5. 5 and 6. 0 after 13 days of bioleaching due to growing amount of the released alkaline matter. 19 Therefore, the p H value of media control throughout bioleaching process was of great im portance for growth of leaching bacteria and extraction of valuable metals. Objective to comprehend the effect of p H control in bioleaching process, in this work, the BS, the BEAS (adjustment p H value at 2. 0) and the SCLS (adjustment p H value at 2. 0 with bacteria-free medium) were carried out at high pulp density. It can be seen from Fig. 4a, 4b that the BEAS maintained a considerably great number of cells and the cell number of bioleaching media had a slight decline from 6. 62×10 8 to 4. 23×108 cells/m L after 9 days of leaching. The growth and activity of the mixed culture were still kept well at so high pulp density of 10%, indicating great potential of bioleaching for treatment of spent batteries
HEAP LEACHING TECHNIQUE in MINING Within the Context of BEST AVAILABLE TECHNIQUES (BAT) Caner Zanbak, Ph D Supported by Euromines – The European Association of Mining Industries, Metal Ores & Industrial Minerals November , 201 2 Introductory Statement by Euromines The objective of mining is to provide valuable minerals needed by the society. For doing so, mining companies extract resources from mineral deposits around the globe and use different techniques to recover the valuable mineral resources from the ore. The choice of a suitable technique, which is both environmentally sound and economically viable, to process mineral resources very much depends on the type of ore which is mined as well as of the physical conditions linked to the location of the mine site. Heap leaching is a tried and tested mining technique enabling the processing of different kinds of ores which could not otherwise be exploite d under viable economic conditions. Modern day heap leaching, which has a relatively low level of energy consumption, is for example successfully used for the beneficiation of certain types of gold ores in Turkey. It contributes to the substantial develop ment of a sustainable gold mining sector in that country and has the potential to help fostering sustainable supply of raw materials in other countries within Europe. This document, prepared by the Turkish Gold Miners Association and supported by Euromine s, has benefited from the contributions of Euromines’ Members as well as of experts from several mining companies, both within Europe and abroad. It aims at: (i) presenting an up to date overview of modern day heap leaching in mining; (ii) providing the re levant information to consider heap leaching in the context of Best Available Techniques (BAT) as defined by the relevant regulatory instruments of the European Union. In this respect, the author would like to express his particular gratitude to the follow ing experts for their valuab le contribution to the present work: - David A. Bickford, General Manager and Chairman of Tüprag Metal Mining, Turkey - Anthony Crews, Vice President & Principal, The Mines Group, Reno, Nevada, USA - Miguel Diaz, Technical Director, AMEC Earth & Environmental, UK - Larry Enloe, Manager, N. American Regional Business Unit, Barrick Gold, Utah, USA. - Louise Grondin, Senior VP, Agnico -Eagle, Sweden - Corina Hebestreit, Director, Euromines, Brussels - Robert Rose, CEO, Andina Minerals, Toronto, O ntaria, Canada (formerly KCA, Reno, Nevada) - Marja Riekkola -Vanhanen, Sr. Biotechnology Advisor, Talvivaara Nickel Mine, Finland i HEAP LEACHING TECHNIQUE in MINING Within the Context of BEST AVAILABLE TECHNIQUES (BAT) TABLE OF CONTENTS 1. INTRODUCTION. 1 2. ORE BENEFICIATION METHODS IN MINING. 3 3. LEACHING IN THE NATURAL ENVIRONMENT. 5 4. LEACHING LIXIVIANTS USED IN MINING. 6 5. BASIC EFFICIENCY FACTORS IN HEAP LEACH PROCESS. 6 6. LEACHING TECHNIQUES USED IN MINING. 9 6. 1 Historical Leach Mining. 10 6. 2 Modern Day Leach Mining. 10 7. DESIGN COMPONENTS OF A HEAP LEACH UNIT. 13 7. 1 Agglomeration. 13 7. 2 Leach Pads. 14 7. 3 Leach Pad Bottom - Ground Surface. 15 7. 4 Leach Pad Liner System. 16 7. 5 Ponds –Solution Management. 17 7. 6 Ore Heap. 19 7. 7 Lixiviant Solution Application and Pregnant Solution Collection. 20 7. 8 Ore Stacking. 21 7. 9 Heap Rinsing and Pad Closure. 22 7. 10 Stability Assessment of Heap Leach Pads. 22 7. 10. 1 Geotechnical Site Investigations and Material Testing:. 23 7. 10. 2 Stability of Leach Piles:. 24 8. REGULATORY DEFINITION OF “BEST AVAILABLE TECHNIQUES”. 25 8. 1 Annex IV of the Directive 2008/1/EC:. 25 8. 2 BREF on Management of Tailings and Waste -Rock in Mining Activities. 26 8. 3 Framework Concept for Evaluation of a Technique in Consideration as a BAT. 27 9. CONCLUSIONS. 32 10. REFERENCES CITED. 33 1 HEAP LEACHING TECHNIQUE in MINING Within the Context of BEST AVAILABLE TECHNIQUES (BAT) 1. INTRODUCTION The objective of the Directive 2006/21/EC on the management of waste from extractive industries and amending Directive 2004/35/EC (the Min ing Waste Directive) is to prevent or reduc e as far as possible any adverse effects on the environment or on human health which are brought about as a result of the management of waste from the extractive industries. Accordingly, the Mining Waste Directive cover s the management of waste from land-based extractive industries, that is to say, the waste arising from the prospe cting, extraction , treatment and storage of mineral resources and from the working of quarries. It requires that measures taken to achieve its objective are based inter alia on Best Available Techniques (BATs), as defined by Directive 96/61/EC of 24 September 1996 concerning integrated pollution prevention and control (IPPC ), which has been codified by Directive 2008/1/EC. Directive 2008/1/EC of 15 January 2008 concerning integrated pollution prevention and control ( the IPPC Directive ), whose objective is to prevent or reduce emissions in the air, provides a detailed definition of „best available techniques‟. Directive 2008/1/EC will be repealed in January 2014 by Directive 2010/75/EU of 24 November 2010 on industrial emissions which provides for a similar definition of „best available techniques‟. The European Inte grated Pollution Prevention and Control (IPPC) Bureau , established under the framework of European Commission's Joint Research Centre (JRC), is entrusted with the task to develop reference documents on Best Available Techniques, called BREFs , through an exchange of information involving the relevant stakeholders, notably the Member States and the industry. BREFs are the main reference documents used by competent authorities in Member States when issuing operating permits for installations that represent a s ignificant pollution potential in Europe. A revised BREF document on “Management of Tailings and Waste -Rock in Mining Activities” was adopted in January 2009 , in accordance with article 21(3) of the Mining Waste Directive. It describes BAT that can be considered as examples of “good practice” for mineral processing, tailings and the waste -rock management of ores that have the potential for a strong environmental impact. This BREF document covers fourteen different metals, including gold, tha t are mined and/or processed in the European Union (EU -15), the acceding countries, the candidate countries and Turkey , Heap leaching techniques are briefly addressed in this version of the BREF document but not sufficiently described. The objective of this document is to provide an overall review of:  leaching process in mining practice, with special emphasis on available techniques applicable for Heap Leaching of very low grade ores that are not considered economical 2 to treat with other BATs ,  availability of applicable technologies by global suppliers,  effectiveness of technologies used in Heap Leaching to control emissions for protection of the environmental media, and  evaluation of the heap leaching process and available techniques within th e context of regulatory BAT concept as a technical supplement to the existing BREF document. Heap leaching is BAT for suitable ores because it allows the economical processing of ore that would otherwise be uneconomic under con ditions that can technically achieve regulatory acceptable levels of environmental risk mitigation. All of the materials used in heap leaching process and industry specifications of materials are available globally. Also, slope stability evaluations of stacked heap leach pads are p erformed using standard geotechnical engineering principles and practice. Therefore, in accordance with the definition of BAT provided by the IPPC Directive and with the objectives of the Mining Waste Directive, emphasis is given to emission minimization c oncepts for the Heap Leaching Technique and design specifications for engineered materials and heap stability analysis methods are not prescribed in this document. 3 2. ORE BENEFICIATION METHODS IN MINING The primary objective of mining is to supply raw materials to downstream users, extracted from ore deposits in the earth‟s crust, using applicable excavation and ore enrichment processes with economically feasible and environmentally sound engineering operations. In a typical metal ore mining operation, ores are selectively excavated from an open pit or underground workings, crushed and milled for futher treatment in ore beneficiation units for enrichment and/or production of metals and metal compounds. There are several mainframe ore preparation/benefi ciation methods available in mining practice based on physical, chemical and smelting processes
05 Planetary Rossby number are temperatures inferred from deceleration measurements aboard the Rossby deformation radius, km 920 1150 Viking 1 (blue). Viking2 (areen). and Pathfinder (red) Landers 170 Solar System/Sun, Atmospheres, Evolution of Atmospheres Planetary Atmospheres: Mars However, the reverse reaction has a long lifetime (10 years). Above the homopause, it is converted into atomic hydrogen and has enough thermal CO + O + M>CO2 + M kinetic energy to escape to space. Ultraviolet spectrometers (where M is any nonreactive molecule) is very slow such that aboard the Mariner 9 spacecraft have detected atomic hydrogen the oxygen atoms tend to form O2 and O3 rather than CO2. The escaping from Mars. time required to convert the present CO atmosphere into one The escape of hydrogen implies that there must be a sink for composed predominantly of CO and O2 is only several thou- O2. Otherwise, the amount of O would double in about sand years. Yet CO is the dominant constituent, while CO and 2 10' years. Loss of oxygen can occur through the oxidation O2 are scarce. How CO is stabilized in the Martian atmosphere of surface materials and/or escape to space. Loss to the surface is a major focus of Martian photochemical studies. requires the continual exposure of surface materials and is not The prevailing view is that CO is oxidized by OH via likely to be significant on 10'-year time scales. On the other hand, atomic oxygen is too heavy to escape on the basis of its CO + OH>CO2 + H thermal motion alone. However, it can escape when ionized oxygen molecules (O+) in the ionosphere recombine with The OH itself is ultimately derived from the photolysis of water vapor. Thus, even though water vapor is a minor constit electrons. The recombination dissociates the molecule into its uent, it may play a very important role in maintaining CO as the constituent atoms with enough kinetic energy to escape. This dominant constituent. Support for the importance of this water nonthermal escape mechanism - known as 'dissociative. chemistry comes from the detection of molecular hydrogen (H2) recombination' - yields an oxygen escape flux that is theoreti- cally expected to adjust itself until it balances the hydrogen loss in the atmosphere and the distribution and abundance of ozone. (i. e. , for every oxygen atom that escapes, two hydrogen atoms Ozone abundances on Mars are much less than on Earth, and they range from below the threshold of detection in warm also escape). In effect, water would be leaving the planet. tropical regions to as high as 150 1015 molecules cm-2 in However, observations suggest that the oxygen escape flux is much less than this prediction, indicating that the atmosphere the cold polar regions. Ozone is produced when O and O is not in redox balance at the present time. combine, and is destroyed by ultraviolet dissociation. However, in the absence of additional atmospheric sinks, ozone would be much more abundant than observed. The H and OH produced by water photolysis provide this additional sink by using the General Circulation same catalytic cycle that operates in Earth's stratosphere, namely Although the meteorological database for Mars lacks the H + O3 >OH + O2 temporal and spatial coverage needed to fully characterize its O + OH->O2 + H general circulation, much can be inferred from it - particularly, Net : O + O3 ->2O2 in connection with general circulation models. Figure 2 is Since the source of odd hydrogen is water vapor, ozone will be a schematic illustration of our present understanding of the depleted in regions where it is abundant, and plentiful in region general circulation. From the data and models, the main components of the general circulation are a zonally symmetric where it is absent. This anticorrelation between ozone and water vapor has been observed and provides support for the importance mean meridional circulation, stationary and propagating of water as a key chemical ingredient of the Martian atmosphere. planetary waves, thermal tides, and a mass flow associated with the seasonal cycling of CO into and out of the polar regions During the early 2000s, methane (CH4) was detected in the Martian atmosphere at the 10 ppb level. The detection is The latter is a unique feature of Martian meteorology. significant since none is expected and its presence at these The mean meridional circulation dominates the lower latitudes and is characterized by a deep Hadley circulation, levels could be the result of a biological source. However, the. reported seasonal and latitudinal variability has been difficult which undergoes significant seasonal variation in structure and to explain since methane is expected to have a long lifetime intensity. At the equinoxes, two roughly symmetric Hadley cells (200-300 years). This variability implies there are strong develop that share a common rising branch centered at or near sources and sinks for methane, which have yet to be identified the equator. At the solstices, the two Hadley cells give way to and confirmed. Furthermore, the Mars Science Laboratory did. a single cross-equatorial circulation. Models indicate that the not detect any significant methane in the Martian atmosphere. intensity of the Hadley cell mass flux varies from 10' kg s-' at. the equinoxes to 1010 kg s-1 at the solstices. during its first year of operations. Thus, the validity of the earlier To some extent, the Hadley cell is a mathematical construct measurements is controversial. in that the circulation is not in itself zonally uniform. In the rising branch, for instance, much of the upward motion may Escape Processes take place in narrow convective plumes embedded in a broader pattern of overall sinking motion. When averaged over longi Escape occurs in the exosphere, which begins on Mars at about tude, the net result is upward flow. Thunderstorms play such 230 km. In the exosphere, the probability of collisions is so a role in the Earth's tropics. While there are good theoretical. small that particles execute ballistic trajectories, some of which reasons to expect that a similar situation exists on Mars, better carry them away from the planet. The most important gases observations are needed to confirm this. that can escape from Mars are hydrogen, oxygen, and nitrogen. The zonal wind component of the mean meridional circu. Molecular hydrogen (H2) is one of the products of water lation has been inferred from temperature data through the gradient wind relationship. An illustration of winds derived in. vapor photolvsis. Below the homopause. H2 is well mixed and pradient wind relationship. An illustration of winds derived in vapor photolysis. Below the homopause, H is well mixed and 171 Solar System/Sun, Atmospheres, Evolution of Atmospheres Planetary Atmospheres: Mars * *** Polar condensation Baroclinic waves, storm systems,fronts Hadley cell Kelvin waves. Tides Dust storm Polar sublimation. Figure 2 Schematic illustration of the general circulation on Mars. this manner is shown in Figure 3. Application of the gradient the thermal data indicate that the westerly jet stream in the winter hemisphere is typically on the order of 100 m s-1. wind relationship to Mars indicates that easterly winds prevail in the tropics at all seasons, and in the summer hemisphere at At high northern latitudes during winter, the Viking Landers the solstices. Westerlies prevail in the winter hemisphere at the. detected eastward propagating disturbances of high- and low- solstices, and at middle and high latitudes during the equi- pressure systems. These traveling disturbances are very similar to terrestrial 'weather' systems in that southerly (northerly) noxes. If zonal winds at the surface are relatively weak, as was. indicated by the Viking, Pathfinder, and Phoenix Landers, then. winds are generally associated with falling (rising) pressures 0. 1 40- BO 170 20 Pressure (h Pa) 1. 0 10. 0 S. 06 30 S 60 N N. 06 60 S 0 30 N Latitude Figure 3 Time-averaged zonal mean winds as a function of latitude and pressure (altitude) for winter in the southern hemisphere. Winds are derived. from thermal emission spectrometer (TES) data using the gradient wind relationship. Red-colored contours are isotherms (K); blue-colored contours are wind speed (m s-1). are windsneed (m s- 172 Solar System/Sun, Atmospheres, Evolution of Atmospheres Planetary Atmospheres: Mars and warm (cold) air advection. Theory suggests that the tran- Local dust storms are also quite common. Based on Mars sient eddies arise from baroclinic instability. Both theory and Global Surveyor (MGs) images, as many as 2o0o local storms occur each Martian year. This gives a daily-averaged rate of 2-3 observations indicate that the dominant zonal wave number of. the transient eddies varies between 1 and 4, and that they storms per Martian day. They have typical lifetimes of less than propagate around latitude circles with phase speeds between several days. Local dust storms tend to form along the edge of. 10 and 20 m s- the polar caps and at the midlatitudes of both hemispheres. These systems often have a distinct convective morphology and can be quite optically thick. Dust Storms Regional storms have been observed at nearly all seasons but are most frequent during southern spring and summer. The surface of Mars is mantled with a fine dusty material that is Most regional storms develop within 30 of latitude, lifted into the atmosphere when surface winds become strong although there is a distinct bias toward the southern hemi- enough to initiate particle motion. Because of the low density sphere. Regional storms can last from days to weeks
Additionally, this is the first direct evidence that it is possible to positively modulate EPS/CPS production and biofilm formation by an acidophilic bacterium of industrial and environ- mental importance by using QS-signaling molecules. Since adherence to the mineral surface and the subsequent formation of biofilms can improve bioleaching (Rohwerder etal. 2003 ; Rohwerder and Sand 2007 ), these results open up a new chemical/biological means which can be explored for improvement of the biomining process. Acknowledgments This work was supported by grants FONDECYT 1080441, FONDECYT 1120295, and CNRS-CONICYT (PICS no. 5270). Alex González was supported by scholarships from CONICYT. Sören Bellenberg and Mario Vera acknowledge the financial support of the program of promotion of Young Scientists from University of Duisburg-Essen. We thank Dr. Michael Handford (Universidad de Chile) for proof-reading the manuscript. References Africa CJ, van Hille RP, Harrison STL (2012) Attachment of Acid- ithiobacillus ferrooxidans and Leptospirillum ferriphilum cultured under varying conditions to pyrite, chalcopyrite, low-grade ore and quartz in a packed column reactor. Appl Microbiol Biotech- nol. doi: 10. 1007/s00253-012-3939-x Barreto M, Jedlicki E, Holmes DS (2005) Identification of a gene cluster for the formation of extracellular polysaccharide precur- sors in the chemolithoautotroph Acidithiobacillus ferrooxidans. Appl Environ Microbiol 71:2902 –2909 Bellenberg S, Leon-Morales F, Holuscha D, Krok B,Vera M, Sand W (2011a). A lectin-based approach for visualization of capsular EPS after attachment and biofilm formation by acidophilic leach-ing bacteria. In Biohydrometallurgy: Biotech key to unlock min-eral resources value. Proceedings of the 19th international Biohydromettallurgy symposium. Central South University Press, Changsha, China Bellenberg S, Vera M, Sand W (2011b). Transcriptomic studies of cap- sular polysaccharide export systems involved in biofilm formation by Acidithiobacillus ferrooxidans. In Biohydrometallurgy: Biotech key to unlock mineral resources value. Proceedings of the 19thinternational Biohydromettallurgy symposium. Central South Uni- versity Press, Changsha, China. Carlier A, Burbank L, von Bodman SB (2009) Identification and characterization of three novel Esa I/Esa R quorum-sensing con-trolled stewartan exopolysaccharide biosynthetic genes in Pan- toea stewartii ssp. stewartii. Mol Microbiol 74:903 –913 Choudhary S, Schmidt-Dannert C (2010) Applications of quorum sensing in biotechnology. Appl Microbiol Biotechnol 86:1267 – Davis RA, Welty AT, Borrego J, Morales JA, Pendon JG, Ryan JG (2000) Rio Tinto estuary (Spain): 5000 years of pollution. Envi-ron Geol 39:1107 –1116 De Bruyn J, Boogerd F, Bos P, Kuenen J (1990) Floating filters, a novel technique for isolation and enumeration of fastidious, aci- dophilic, iron-oxidizing, autot rophic bacteria. Appl Environ Microbiol 56:2891 –2894 Decho AW, Frey RL, Ferry JL (2011) Chemical challenges to bacterial AHL signalling in the environment. Chem Rev 111:86 –99 Demergasso C, Galleguillos F, Soto P, Serón M, Iturriaga V (2010) Microbial succession during a heap bioleaching cycle of low grade copper sulfides: does this knowledge mean a real input for industrial process design and control. Hydrometallurgy 104:382 –390 Echeverría A, Demergasso C (2009) Assessment of microbial adhesion in mixed cultures to sulfide minerals using CARD-FISH techni- ques. Adv Mat Res 71 –73:83 –86 Farah C, Vera M, Morin D, Haras D, Jerez CA, Guiliani N (2005) Evidence for a functional quorum-sensing type AI-1 system in the extremophilic bacterium Acidithiobacillus ferrooxidans. Appl En- viron Microbiol 71:7033 –7040 Flemming HC, Wingender J (2010) The biofilm matrix. Nat Rev Microbiol 8:623 –633 Galloway WR, Hodgkinson JT, Bowden SD, Welch M, Spring DR (2011) Quorum sensing in gram-negative bacteria: small-molecule3736 Appl Microbiol Biotechnol (2013) 97:3729 –3737 modulation of AHL and AI-2 quorum sensing pathways. Chem Rev 111:28 –67 Gehrke T, Telegdi J, Thierry D, Sand W (1998) Importance of extra- cellular polymeric substances from Thiobacillus ferrooxidans for bioleaching. Appl Environ Microbiol 64:2743 –2747 Gonzalez-Toril E, Llobet-Brossa E, Casamayor EO, Amann R, Amils R (2003) Microbial ecology of an extreme acidic environment, the Tinto River. Appl Environ Microbiol 69:4853 –4865 Harneit K, Goksel A, Kock D, Klock JH, Gehrke T, Sand W (2006) Adhesion to metal sulfide surfaces by cells of Acidithiobacillus ferrooxidans ,Acidithiobacillus thiooxidans and Leptospirillum ferrooxidans. Hydrometallurgy 83:245 –254 Janczarek M (2011) Environmental signals and regulatory pathways that influence exopolysaccharide production in rhizobia. Int J Mol Sci 12:7898 –7933 Kozlova EV, Khajanchi BK, Sha J, Chopra AK (2011) Quorum sens- ing and c-di-GMPdependent alterations in gene transcripts and virulence-associated phenotypes in a clinical isolate of Aeromo- nas hydrophila. Microb Pathog 50:213 –223 Labbate M, Zhu H, Thung L, Bandara R, Larsen MR, Wilcox MD, Givskov M, Rice SA, Kjelleberg S (2007) Quorum-sensing reg- ulation of adhesion in Serratia marcescens MG1 is surface de- pendent. J Bacteriol 189:2702 –2711 Mackintosh M (1978) Nitrogen fixation by Thiobacillus ferrooxidans. J Gen Microbiol 105:215 –218 Mangold S, Harneit K, Rohwerder T, Claus G, Sand W (2008) Novel combination of atomic force mi croscopy and epifluorescence microscopy for visualization of leaching bacteria on pyrite. Appl Environ Microbiol 74:410 –415 Marketon MM, Glenn SA, Eberhard A, Gonzalez JE (2003) Quorum sensing controls exopolysaccharide production in Sinorhizobium meliloti. J Bacteriol 185:325 –331 Mykytczuk NC, Trevors JT, Twine SM, Ferroni GD, Leduc LG (2010) Membrane fluidity and fatty acid comparisons in psychrotrophicand mesophilic strains of Acidithiobacillus ferrooxidans under cold growth temperatures. Arc Microbiol 192:10051018 Parsek MR, Greenberg EP (2005) Sociomicrobiology: the connections between quorum sensing and biofilms. Trends Microbiol 13:27 –33 Rawlings DE (2002) Heavy metal mining using microbes. Annu Rev Microbiol 56:65 –91 Remonsellez F, Galleguillos F, Moreno-Paz M, Parro V, Acosta M, Demergasso C (2009) Dynamic of active microorganisms inhabiting a bioleaching industrial heap of low-grade copper sulfide ore monitored by real-time PCR and oligonucleotideprokaryotic acidophile microarraymbt_112. Microbial Bio-technol 6:613 –624 Riedel K, Hentzer M, Geisenberger O, Huber B, Steidle A, Wu H, Hoiby N, Givskov M, Molin S, Eberl L (2001) N-acylhomoserine- lactone-mediated communication between Pseudomonas aeruginosa and Burkholderia cepacia in mixed biofilms. Microbiology 147:3249 –3262 Rivas M, Seeger M, Holmes DS, Jedlicki E (2005) A lux-like quorum sensing system in the extreme acidophile Acidithiobacillus fer- rooxidans. Biol Res 38:283 –297 Rivas M, Seeger M, Jedlicki E, Holmes DS (2007) Second acyl homoserine lactone production system in the extreme acidophile Acidithiobacillus ferrooxidans. Appl Environ Microbiol 73:3225 – 3231Rohwerder T, Sand W (2007) Oxidation of inorganic sulfur com- pounds in acidophilic prokaryotes
0-30 min for strong acids, and 0-120 min for weak phosphoric acid were selected due to slow dissolution in the latter. Samples of 1 m L volume were withdrawn at different time intervals. A tenfold dilution 2. Experimental with Millipore water was used for the withdrawn solution samples and assayed for calcium and phosphorous (dissolved as phosphate) using 2. 1. Fluorapatite mineral sample and disc ICP-AES/MS instrument (Varian ICP Model Liberty 200). The fluoride analysis of the leach liquors was conducted using a commercial fluoride The natural FAP mineral sample received from ‘Cerro de Mercado' combination electrode (Orion, Model 9609BNWP) in conjunction with mine site in Durango, Mexico was crushed, ground and digested and a Thermo Scientific Orion Star A214 Benchtop p H/ISE meter. quantitatively assayed using inductively coupled plasma-atomic emis- sion spectroscopy (ICP-AES)/mass spectroscopy (ICP-MS). The XRD analysis was conducted using GBC Enhanced Mini-material Analyser Rotation speed (EMMA) Theta-Theta Diffractometer. The rotating disc was prepared using a crystal of the natural FAP controller mineral sample described above. It was immersed in an epoxy solution, allowed to settle down under room temperature, cylindrically shaped FAP disc fitted and fitted to a PVC shaft. A flat disc surface was obtained by cutting a with a PVC shaft cross-section using a diamond saw and this surface was smoothened using P800 and P1200 silicon carbide papers. A schematic diagram of the experimental set up used in this study is shown in Fig. 1. Several Glass reactor with a water jacket discs of different surface area in the range 0. 4-0. 7 cm. were used in this study with different acid concentrations and temperatures. Therefore, the results in Section 3 are presented as concentrations of dissolved species (mol L-1) for the same disc of area 0. 675 cm2 and moles per unit area (mol m -2) in other cases with different disc areas, as required Fig. 1. Experimental set-up used in rotation disc study (the disc was lowered to for comparison. expose the mineral surface to solution at t = O min) 220 A. M. T. S. Bandara and G. Senanayake Hydrometallurgy 184 (2019) 218-236 Table 3 Elemental assays of feed materials. Element Mass % Na Mg Al Si P Fc S K Ca Feo Sr Th U TREEs This work (FAP-2) 0. 25 0. 01 0. 22 13. 4 2. 00 0. 09 0. 13 34. 9 0. 21 0. 05 1. 24 Previous worka (FAP-1) 0. 19 0. 01 0. 09 12. 6 2. 11 0. 00 0. 09 33. 8 0. 22 0. 32 0. 55 Previous workb (Concentrate) 0. 13 0. 49 2. 23 9. 05 7. 95 1. 70 0. 10 0. 58 24. 8 2. 64 0. 28 0. 48 0. 03 4. 91 a Bandara and Senanayake (2015). b Stone et al. (2016). C Fluoride assays based on XRF, TREEs = total rare earth elements. 100 3. Results and discussion 80 60 3. 1. Characterization 40 A1. 20 According to Table 3, the mass percentages of calcium, phosphorous. su 100- and fluorine in the FAP sample used in this work and previous work 80 (Bandara and Senanayake, 2015) are reasonably close. The presence of n 60 some carbonate-FAP is evident from the XRD analysis (Fig. 2). The 40 elemental assays listed in Table 3 also indicate the presence of minor 20 (ii) quantities of sodium, magnesium, silicon, sulphur, potassium, iron, strontium and rare earth elements (1. 24%, w/w) in the FAP mineral 80 sample. The compositions of Al, Si, Fe, K and TREEs (total rare earth 60 elements) in the concentrate are much higher than those in FAP sam- R 40 ples (Table 3). 20 (ii) 10 20 30 40 50 60 70 80 90 3. 2. Comparison of dissolution/leaching results in different acids 2-Theta / degrees Fig. 2. XRD analysis of (i) FAP sample: Comparison with standard patterns; (i) The extent of dissolution (Cy) where Y = calcium, phosphate, FAP (01-071-5050) and (ii) carbonate-FAP (01-073-9696) fluoride (mmol L-1) and Y = REEs (μmol L-1) from the FAP disc in 0. 5 mol L -1 acids at 25 °C during the first 30 min is illustrated in Fig. 3 for comparison. The change in concentration with time is linear in all (a) Ca in 0. 5 mol L-l acids (b) P in 0. 5 mol L- acids Fig. 3. Concentrations of (a) calcium, (b) phosphate, (c) lanthanum and (d) total rare earth elements (sum of lanthanum, cerium, praseodymium and neody- E OHCI 1. 6 OHC1 mium) dissolved from FAP-2 disc in 0. 5 mol L - 1 acids 0 HNOs XHSO4 HNOs at 25°℃ and 450rpm (leach duration = 30 min); OHCIO4 1. 2 XH2SO4 fluoride concentrations in final liquors = 0. 26 OHCIO4 Hs PO4 mmol L-1 (HCI), 0. 14mmol L-1 (HNOs), 0. 13 0. 8 0. 8 mmol L-1 (H2SO4) and 0. 15 mmol L-1 (HCIO4) after 30 min and 0. 19 mmol L-1 (Hg PO4) after 120 min. 0. 4 10 20 30 10 20 30 Time/ min Time / min c) La in 0. 5 mol L- acids (d) TREEs in 0. 5 mol L- acids 3 TREEs = Sum of La, Ce, Pr and Nd HNO HNO XH2SO4 XHz SO4 2. 4 OHCIO4 OHCIO4 Hs PO4 6. 0 Hs PO4 1. 6 1 3. 0 0. 8 0. 0 10 20 0. 0 30 10 20 30 Time/min Time/min 221 A. M. T. S. Bandara and G. Senanayake Hydrometallurgy 184 (2019) 218-236 (a) Ca in 0. 1 mol L-d acids (b) P in 0. 1 mol L-l acids 0. 4△HCI ●HCI04 Hs PO4 OHNO: ●HCIO4 0. 3HSO 0. 3 He SO4 u) OHNO3 0. 2 中 0. 13 0. 1 R SII 0. 02 0 10 20 30 0 10 20 30 Time / min Time/min (c) Ca in 0. 5 mol L- acids (d) P in 0. 5 mol L-d acids 1. 2 ] HCI ●HC104 △HCI 自 Hs PO4 O-HNO: [ow) ●HC1O4 HSO4 Hz SO4 D 0. 8 (A)d Q 0. 4 0. 4 ← 0. 0 20 30 0 10 20 30 0 10 Time / min Time / min Fig. 4. Dissolved amounts (ny) of calcium and phosphate in (a-b) 0. 1 mol L-1 acids and (c-d) 0. 5 mol L-1 acids at 25 °℃ and 450 rpm (leach duration = 30 min) Table 4 Dissolution results of calcium, phosphate and fluoride from disc study. Dissolved element Acid type Dissolved amounts of Ca, P and F in different acid solutions (mol m-2) after 30 min 0. 1 mol L-1 (25°C) 0. 5 mol L-1 (25 °℃) 1. 0 mol L-1 (25°C) 0. 5 mol L-1 (50°C) 0. 5 mol L-1 (70 °℃) 0. 5 mol L-1 (90°C) Ca HCI 0. 22 1. 07 1. 85 5. 56 11. 1 25. 9 HNO3 0. 19 0. 86 1. 62 4. 04 8. 59 一 HCIO4 0. 32 0. 76 1. 03 2. 29 7. 11 H2SO4 0. 30 0. 83 1. 19 3. 54 7. 32 Hs PO4 0. 16 0. 22 0. 28 1. 02 1. 75 2. 44 P HCI 0. 13 0. 67 1. 15 3. 34 6. 93 16. 2 HNO3 0. 11 0. 52 0. 98 2. 48 6. 19 HCIO4 0. 36 0. 47 0. 59 1. 51 4. 44 H2SO4 0. 18 0. 49 0. 68 1. 96 4. 24 F HCI 0. 04 0. 19 0. 32 0. 89 1. 63 3. 50 HNO3 0. 04 0. 14 0. 28 0. 70 1. 74 HCIO4 0. 05 0. 13 0. 19 0. 50 1. 27 H2SO4 0. 05 0. 14 0. 19 0
2 <B>Process mineralogy </B> Mineralogical characteristics are amongst the most important factors determining leachability, leach time, reagent consumption, insoluble losses, scale formation and equipment performance (Benvie, 2007; Pownceby <I>et al</I>. , 2007; Baum, 1999). Despite the apparent operational simplicity, the coarse to very coarse nature of heap leach feeds produces a complex association of mineral species and mineral-pore spatial arrangements (texture) which impact on leaching outcomes. A thorough understanding of the mineralogical composition of the ore (in terms of both valuable minerals as well as gangue minerals), as well as the leach reaction kinetics and acid consumption under a range of operating conditions, is required to determine the optimal reagent strength specifications (especially in terms of acid). Insufficient attention to mineralogy Downloaded by [Monash University Library] at 20:45 27 November 2015 Accepted Manuscript 113 can lead to inadequate understanding of the reasons for variable ore performance and to much higher risks in plant design and commercial heap performance. This is discussed in more detail in sections 3. 1 and 3. 4. The differences in feed composition require different ore preparation procedures and especially ore blending for heap stacking. In recent years, automated mineralogy has become established as an essential enabling technology for the reliable acquisition of statistically sound comprehensive mineralogical and metallurgical data (Gottlieb, 2008; Mular, <I>et al</I>. , 2005). This quantitative data is derived from images of the mineralogically classified ores or plant products in question. A large range of techniques is available for the acquisition of image data, and the ability of each of these systems to discriminate between mineral species varies widely (Benvie, 2007; Pownceby <I>et al</I>. , 2007). Recent developments in X-ray CT as an advanced diagnostic and non-destructive technique have indicated the potential for the technology to become a tool for the acquisition of 3- D mineralogical and structural data in the large ore particles used in heap leaching operations (Cnudde and Boone, 2013; Golab <I>et al</I>. , 2013; Dhawan, <I>et al</I>, 2012; Ghorbani <I>et al. ,</I> 2011b, 2013c; Miller <I>et al</I>. , 2003). Conclusion and Outlook Heap leaching has become a well-established technology choice for the treatment of low-grade ores over the past 50 years, enabling the economic exploitation of marginal deposits, often in remote locations in many parts of the world. Heap leaching has permitted many developing countries a first entry into the commodities market, paving the road for more sophisticated technology to follow. However, the focus has firmly remained on acid leaching of copper oxides, Downloaded by [Monash University Library] at 20:45 27 November 2015 Accepted Manuscript 114 uranium ores and cyanide leaching of gold ores. The oxidative leaching of secondary copper sulphides and refractory gold ores are the only other applications that have emerged at a significant scale since the late 80s, promoted by the realisation that leaching of these minerals is generally supported by natural bacterial oxidation. In terms of heap technology, oxidative leaching requires aeration of heaps through aeration pipes placed underneath the heap before it is stacked, or through managed rinse-rest cycling. Furthermore, due to the different time-scale at which they leach (over years rather than months), maintaining high heap permeability has become a critical focus of heap design and management. Heap compaction during stacking and operation can significantly inhibit homogeneous solution flow through the bed, compounded further by rock decrepitation upon long-term exposure to acid and secondary precipitation of leached metals in the interstitial pores. Therefore, preparing a carefully blended feed to stack heaps and operating its irrigation so to avoid flooding and channelling is critical. However, the relationship between particle size distribution, ore mineralogy, nature of packing, heap height and heap permeability remains poorly understood and hence difficult to manage effectively. The long leach times of oxidative processes are founded on the slow rate of oxygen uptake from air, and slow diffusion of solutes within the pores of larger rock particles and through stagnant zones within the packing. Both these aspects are compounded by the distribution of liquid and gas in the bed and thus directly linked to heap permeability. It is therefore postulated that the inability to maintain effective percolation through heaps over the longer term is the single biggest obstacle to broader uptake of this technology in the mining industry. Downloaded by [Monash University Library] at 20:45 27 November 2015 Accepted Manuscript 115 Many interventions have been proposed and implemented to improve the performance of heaps, and some of them address the core issue of heap permeability. These include ore agglomeration, certain stacking methods, low impact irrigation, pulse irrigation schemes, building shallow heaps etc. , all which have contributed to an overall incremental improvement in extraction from heaps over the past 20 years. But there has not been a true breakthrough intervention that allows oxidative heap leaching to operate at the same time scale as laboratory columns indicate is possible in the absence of permeability constraints. It is particularly in this area where future development work in heap leach technology must focus, be it through further improvements in the blending and agglomeration of ore, stacking methods and heights, use of filler material to maintain macro porosity, irrigation schemes or combinations of these. Mineralogical characteristics of the particular ore under consideration will need to be taken into account more systematically. Also, dedicated instrumentation to monitor gas and solution flow within heaps is still very limited and there is much scope for new technology to be developed. Once the obstacle of long leach times and slow extraction rates can be overcome, heap leaching offers significant potential for further innovation. Many new ideas for heap leach processes, whether based on different commodities (Zn, Ni, PGMs), or novel chemistry (use of thiosulphate for gold, ammonia for base metals, chloride or thermophile micro-organisms for chalcopyrite) appear feasible at the laboratory scale, but are likely to be hampered by the same dilemma of heap permeability at the industrial scale. Significant also for sulphide heap leaching is the auto-thermal nature of heaps, resulting in a self- heating effect from the exothermic consumption of oxygen. Much work has been done in Downloaded by [Monash University Library] at 20:45 27 November 2015 Accepted Manuscript 116 understanding, modelling and controlling this effect for efficient operation at elevated temperatures, at which reaction rates are generally at their fastest, and at which thermophilic micro-organisms can thrive, which have shown a unique ability to assist in the dissolution of chalcopyrite. Effective heat control hinges, however, on good distribution of both gas and solution through the heap, and therefore again is linked to maintaining good heap permeability. Environmental concerns around heap leaching require critical discussion. On the one hand, heap leaching does represent a significant energy saving (and reduction of the associated carbon footprint) relative to conventional minerals processing by obviating the need for milling, but, on the other hand, the relatively uncontrolled flows of large solution inventories containing corrosive and toxic chemicals through sprinklers, heaps, drainage systems and ponds offers many opportunities for leakage and contamination if not carefully managed. Spent heaps present as much of an environmental legacy as tailings dams. Although there have been some studies evaluating the environmental footprint of various Cu processing routes, there is still no clear indication as to the relative merits or demerits of heap leaching, and further study is indicated. Incidentally, heap leach technology could also play a role in the low cost recovery of metals from secondary resources to reduce the need for primary mining, as has already been shown in the context of certain e-wastes. In conclusion then, it is likely heap leaching will remain the technology of choice for treating low-grade copper and gold ores in remote locations, but for it to become attractive for higher grades and different commodities, some significant improvements in achieving and maintaining good heap permeability for rapid and nearly complete extraction are still required. Care needs to Downloaded by [Monash University Library] at 20:45 27 November 2015 Accepted Manuscript 117 be taken not to treat heap leaching as some sort of ‘primitive’ technology. For its optimal operation, fairly comprehensive knowledge of the ore and the mechanisms of heap leaching is required to understand and evaluate the impact of any particular intervention to improve performance. The failure to appreciate the complexity of heaps has resulted in many failed operations, historically and still at present. The long-term success of heap leaching as a technology choice requires a concerted high-level cross-disciplinary engineering approach from research and development to design to construction to operation to closure, as should be expected for the management of any modern technology. Acknowledgements The authors are grateful to Gavin Jones from Research Contracts and Intellectual Property Services (RCIPS), University of Cape Town, South Africa, for his support in giving us access to the international patent database. Financial support from the South Africa Research Chair Initiative (SARCh I) Chair in Mineral Beneficiation, and a Research Niche Area (RNA) grant from the National Research Foundation (NRF) of South Africa are also acknowledged. References Abbruzzese C. , Fornyari P. , Massidda R. , Veglio F. , Ubaldini, S. , 1995. Thiosulphate leaching for gold hydrometallurgy, Hydrometallurgy 39, 265-273. Acevedo, F. , 2002. Present and future of bioleaching in developing countries. Electronic Journal of Biotechnology, 52-56
We interpret the Th-rich side of the data en- logues for Th, and from compilations by Taylor et al. [1991] velope as bounded by the average compositions of large and Papike et al. [1998]), we may estimate the concentration chunks of PKT midcrustal to upper crustal materials whose of Th in the mantle from which the picritic glasses derived. average Fe O concentrations range from ~6 to >10 wt % and Assuming a range of bulk D values of 0. 02 to 0. 05 for melt in JOLLIFF ET AL. : LUNAR TERRANES 4209 Table 2. Example Th Concentrations and Volumes Used to Calculate Th Mass Balance Th, Surface Depth, Volume Volume Density, Mass, Sum, % Th ppm Area, % km Adjusted % (crust) g cm-3 % mass % (crust) FHT-An* 0. 3 24. 8 90 9. 86x108 41. 3 2. 85 40. 3 84. 5 53. 6 (FHT total) FHT-O* 1. 0 48. 2 70 1. 12x10. 43. 7 2. 95 44. 2 PKT undiff. 4. 8 10. 0 60 2. 20x108 8. 5 3. 03 8. 9 8. 9 40. 4 (PKT total) SPAT-inner 1. 4 5. 3 40 7. 87x107 3. 1 3. 05 3. 2 6. 5 5. 8 (SPAT total) SPAT-outer 0. 7 5. 7 40 8. 46x107 3. 3 2. 95 3. 3 Other mare. 2. 2 6. 0 1 2. 28×106 0. 1 3. 10 0. 1 0. 1 0. 2 (other mare) Average crust* 1. 05 70 2. 55x109 2. 93 Th values for FHT-An and FHT-O assume that the average Th concentrations of surface materials as given in Table l repre- sent a veneer that incorporates material added by Imbrium ejecta [Haskin et al. , 1999] Otherwise, FHT-O is taken to be representa- tive of material in the lower 40 km throughout the terrane. To calculate the adjusted volumes, the FHT-An is taken to be 50 km thick above 40 km of lower crust with the composition of FHT-O. In this example the outer part of the FHT is taken to have a thin veneer of basin ejecta over an upper crust (30 km) of FHT-An composition and a lower crust of FHT-O composition. Also, com- pared to Table 1 values, the surface area of the PKT is reduced to 10% to compensate for lateral distribution of Th-rich material by multiple basin impacts. t Other mare” refers to prominent, basin-filling mare basalt located within the boundaries of the FHT. For these calculations, "other mare, mare-nonmare mixed" pixels of Table 1 have been distributed between “other mare" and "FHT-O. " +The volume listed for "average crust' is the sum of the individual terranes. Densities are estimated. equilibrium with an olivine-pyroxene residue (see Snyder et Taylor [1982], the ~0. 07 ppm estimated by Rasmussen and al. [1995b] compilation of mineral/melt D values), the meas- Warren [1985] and Warren and Rasmussen [1987], and the ured Th concentrations of 0. 2-0. 5 ppm for Apollo 15 green 0. 112 ppm estimated by Drake [1986]. This value can be re- glass and Apollo 17 orange glass, respectively [Taylor et al. , duced significantly if the surface area of the PKT is less than 1991; Korotev, 1998], indicate mantle residue compositions it appears from the surface distribution of Th. This is likely to as low as 0. 005-0. 025 ppm Th, significantly less than the be the case, especially if one considers that some 8-10 basin value of 0. 04 ppm in the Th mass-balance model of Table 3. impacts have struck the PKT region [De Hon, 1974; Wil- At the high end of the range, however, picritic glasses that helms, 1987; Spudis, 1993], and especially if there was a giant have Th concentrations 50-100 times chondrite levels may Procellarum impact event [e. g. , Wilhelms, 1987]. In the have been derived from mantle sources of significantly higher model described below, we assume that lateral mixing as a re- Th concentration, e. g. , 0. 13 ppm. If we assume that the sult of basin impacts within the PKT has increased its areal source regions of higher Th concentration are localized be- distribution by 50%; thus we reduce its areal signature from neath the PKT, making up some 15% of the mantle volume, 16. 7% (Table 1) to 10% (Table 2). then 0. 04 ppm is a reasonable estimate of the bulk-mantle Th Furthermore, the crustal Th concentrations used in the concentration. At 0. 04 ppm the mantle (lower plus upper) model reflected in Table 2 are based on a presumption that the would contain only on the order of 20% of the Moon's Th. surface exposures of the SPAT and the FHT were contami- Using the surface areas as shown in Table 1 to calculate the nated significantly by Th-rich Imbrium ejecta [Haskin, 1998; crustal Th mass balance and adding a mantle component Haskin et al. , 1999, Haskin et al. , submited manuscript, yields a bulk lunar Th concentration of 0. 168 ppm. This es- 1999]. Thus the Th concentrations shown in Table 2 are timate is significantly greater than the 0. 125 ppm estimated by lower than those that characterize surface materials, as listed Table 3. Mass Balance for Whole-Moon Th Content Thickness, Volume, Density, Mass, Th, % Th km km. g cm-i % of total ppm (whole Moon) Whole Moon 1738 2. 20x10'0 3. 34 100. 0 0. 142 Core 300 1. 13x108 4. 20t 0. 7 0. 00 0 Lower mantle (LM) 968 8. 43x109 3. 45 39. 4 0. 04 11. 1 Upper mantle (UM) 400 1. 09×1010 3. 35 49. 7 0. 04 14. 0 Crust (average) 70 2. 55×109 2. 92 10. 2 1. 05 74. 9 *Values for the core and mantle Th concentrations are assumed (see text). The crustal average Th concentration of 1. 05 ppm is the output from Table 2. The Th mass balance for the whole Moon is the sum of the mass fraction of each section of the Moon tirmes its average Th concentration. +Core density from Taylor [1982]. According to this model, the whole-Moon Th concentration would require a bulk Moon of ~5 times the CI chondritic average Th concentration (29. 4 ppb; [Anders and Grevesse, 1989]). 4210 JOLLIFF ET AL. : LUNAR TERRANES surface area (%) of the Th in the crust, the FHT would contain 54%, and the 10 12 14 16 SPAT would contain ~6%. At these values the Th concentra- 8 0. 20 tion in the crust alone would correspond to a whole-Moon (a) concentration of 0. 107 ppm, and with the addition of mantle Th the global Th concentration would be 0. 142 pm. Adding 0. 18 6 ppm Th a similar mantle component as above to the Drake [1986] crustal estimate would yield 0. 147 ppm bulk Moon Th, which 5 ppm Th is in close agreement with our estimate. 0. 16 The preceding discussion treats the terranes in terms of av- 4 ppm Th erage Th concentrations. We emphasize, however, that rock samples from the Apollo sites provide evidence of a range of 0. 14 Th concentrations for crustal materials within the PKT. Im- pact-melt breccias such as those sampled at Apollo 14 and 15 6 0. 12 have compositions that reflect integrated crustal sections ex- p humed by basin impacts (i. e. , Imbrium). Some of these im- [4] 1. 6 2. 1 2. 6 3. 1 3. 6 pact-melt breccias have Th concentrations >15 ppm. Apollo volume of PKT (km3) x 108 15 KREEP basalts, which are compositionally very similar to uool the mafic impact-melt breccias, have 12-14 ppm Th, and a few rare, KREEP-like rocks have even higher Th concentra- 0. 18 M tions (Apollo 12 KREEP basalt 12023,118: 49 ppm [Laul, (b) 1986]; Apollo 16 ultra KREEP impact melt: 21-36 ppm Th 0 [Lindstrom, 1984]; and Apollo 14 ultra-KREEP impact melt 0. 16 ym 14161,7233: 50 ppm Th [Jollif, 1998]). Thus it is likely that some regions of the PKT crust have local Th concentrations 0. 14 well in excess of 5 ppm and others have less. The mass-balance model described above is driven by Th concentrations at the surface, as indicated by remote sensing 0. 12- and by the Th concentrations of sampled lunar materials. Us- ing reasonable inputs, we obtain a bulk Moon Th concentra- 0. 10 tion of 0
Y. , Deveci, H. , 2012. Aqueous metal recovery techniques from e-scrap: Hydrometallurgy in recycling. Miner. Eng. 25, 28-37. doi:10. 1016/j. mineng. 2011. 09. 019. 147. Ubaldini, S. , Fornari, P. , Massidda, R. , Abbruzzese, C. , 1998. An innovative thiourea. gold leaching process. Hydrometallurgy 48, 113-124. doi:10. 1016/S0304- 386X(97)00076-5. 148. Ubalua, A. , 2010. Cyanogenic Glycosides and the fate of cyanide in soil. Aust J. Crop Sci. 4, 223-237. 149. US National Research Council, Committee on Critical Mineral Impacts of the U. S. Economy, Committee on Earth Resources. Minerals, critical minerals, and the U. S. economy. Washington, DC: The National Academies Press; 2008. 150. Vardanyan, A. , Stepanyan, S. , Vardanyan, N. , Markosyan, L. , Sand, W. , Vera, M. Zhang, R. , 2015. Study and assessment of microbial communities in natural and. commercial bioleaching systems. Miner. Eng. 81, 167-172. doi:10. 1016/j. mineng. 2015. 05. 001. 151. Vera, M. , Schippers, A. , Sand, W. , 2013a. Progress in bioleaching: fundamentals and mechanisms of bacterial metal sulfide oxidation--part A. Appl. Microbiol. Biotechnol. 97, 7529-41. doi:10. 1007/s00253-013-4954-2. 152. Waksman, S. a. , Joffe, J. S. , 1922. Microorganisms Concerned in the Oxidation of Sulfur in the Soil. J. Bacteriol. 7, 239-256. doi:10. 1097/00010694-192205000-00002 153. Wang, F. , Huisman, J. , Balde, K. , Stevels, A. , 2012. A systematic and compatible classification of WEEE, in: Electronics Goes Green 2012+ (EGG). IEEE, Berlin, pp. 1-5 154. Wang, F. , Ruediger, K. , Daniel, A. , Jinhui, L. , 2013. E-waste in China: A country report. Bonn. 155. Wang, M. , Odoom-Wubah, T. , Chen, H. M. , Jing, X. L. , Kong, T. , Sun, D. H. , Huang, J. L. , Li, Q. B. (2013). Microorganism-mediated synthesis of chemically difficult-to- synthesize Au nanohorns with excellent optical properties in the presence of hexadecyltrimethylammonium chloride. Nanoscale, 5, 6599-6606. 156. Wang, J. , Bai, J. , Xu, J. , Liang, B. , 2009. Bioleaching of metals from printed wire boards by Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans and their mixture. J. Hazard. Mater. 172, 1100-1105. doi:10. 1016/j. jhazmat. 2009. 07. 102 157. Wang, Y. , Gao, H. , Sun, J. , Li, J. , Su, Y. , Ji, Y. and Gong, C. , 2011. Selective reinforced. competitive biosorption of Ag (I) and Cu (II) on Magnetospirillum gryphiswaldense. Desalination, 270(1), pp. 258-263. 158. Wang, Z. , Zhang, B. , Guan, D. , 2016. Take responsibility for electronic-waste disposal. Nature 536, 23-25. doi:10. 1038/536023a. 159. Watling, H. , 2015. Review of biohydrometallurgical metals extraction from polymetallic mineral Rresources. Minerals 5, 1-60. doi:10. 3390/min5010001. 160. Won, S. W. , Kwak, I. S. , Yun, Y. -S. (2014). The role of biomass in polyethylenimine. coated chitosan/bacterial biomass composite biosorbent fiber for removal of Ru from acetic acid waste solution. Bioresource Technology, 160, 93-97. 38 ACCEPTEDMANUSCRIPT 161. Wu, H. Y. , Ting, Y. P. , 2006. Metal extraction from municipal solid waste (MSW) incinerator fly ash - Chemical leaching and fungal bioleaching. Enzyme Microb. Technol. 38, 839-847. doi:10. 1016/j. enzmictec. 2005. 08. 012. 162. Xiang, Y. , Wu, P. , Zhu, N. , Zhang, T. , Liu, W. , 2010. Bioleaching of copper from waste printed circuit boards by bacterial consortium enriched from acid mine drainage. J. Hazard. Mater. 184, 812-818. doi:10. 1016/j. jhazmat. 2010. 08. 113. 163. Xu, T. J. , Ramanathan, T. , Ting, Y. P. , 2014. Bioleaching of incineration fly ash by Aspergillus niger - Precipitation of metallic salt crystals and morphological alteration of the fungus. Biotechnol. Reports 3, 8-14. doi:10. 1016/j. btre. 2014. 05. 009. 164. Yamane, L. H. , de Moraes, V. T. , Espinosa, D. C. R. , Tenorio, J. A. S. , 2011. Recycling of WEEE: Characterization of spent printed circuit boards from mobile phones and. computers. Waste Manag. 31, 2553-2558. doi:10. 1016/j. wasman. 2011. 07. 006. 165. Yang, Y. , Chen, S. , Li, S. , Chen, M. , Chen, H. , Liu, B. , 2014. Bioleaching waste printed circuit boards by Acidithiobacillus ferrooxidans and its kinetics aspect. J. Biotechnol. 173, 24-30. doi:10. 1016/j. jbiotec. 2014. 01. 008. 166. Yong, P. , Rowson, N. A. , Farr, J. P. G. , Harris, I. R. , Macaskie, L. E. (2003). A novel. electrobiotechnology for the recovery of precious metals from spent automotive catalysts Environmental Technology, 24, 289-297. Zammit, C. M. , Cook, N. , Brugger, J. , Ciobanu, C. L. , Reith, F. , 2012. The future of. 167. biotechnology for gold exploration and processing. Miner. Eng. 32, 45-53 doi:10. 1016/j. mineng. 2012. 03. 016. 168. Zeng, X. , Gong, R. , Chen, W. Q. , Li, J. , 2016. Uncovering the recycling potential of. "new" WEEE in China. Environ. Sci. Technol. 50, 1347-1358. doi:10. 1021/acs. est. 5b05446. 169. Zeng, X. , Song, Q. , Li, J. , Yuan, W. , Duan, H. , Liu, L. , 2015. Solving e-waste problem using an integrated mobile recycling plant. J. Clean. Prod. 90, 55-59 doi:10. 1016/j. jclepro. 2014. 10. 026. 170. Zhang, K. , Schnoor, J. L. , Zeng, E. Y. , 2012. E-Waste recycling: Where does it go from. here. Environ. Sci. Technol. 46, 10861-10867. doi:dx. doi. org/10. 1021/es303166s. 171. Zhang, M. Y. , Zhang, K. S. , De Gusseme, B. , Verstraete, W. (2012). Biogenic silver nanoparticles (bio-Ag-0) decrease biofouling of bio-Ag-0/PES nanocomposite membranes. Water Research, 46, 2077-2087. 172. Zhu, N. , Xiang, Y. , Zhang, T. , Wu, P. , Dang, Z. , Li, P. , Wu, J. , 2011. Bioleaching of metal concentrates of waste printed circuit boards by mixed culture of acidophilic bacteria. J. Hazard. Mater. 192, 614-619. doi:10. 1016/j. jhazmat. 2011. 05. 062. 173. Zhuang, W. -Q. , Fitts, J. P. , Ajo-Franklin, C. M. , Maes, S
03290. waste sludges by means of Thiobacillus ferrooxidans. Waste. Manag. 22, 667-675. Wei, Y. , Shimaoka, T. , Saffarzadeh, A. , Takahashi, F. , 2011. Mineralogical [URL] characterization of municipal solid waste incineration bottom ash with an emphasis Vestola, E. A. , Kuusenaho, M. K. , Narhi, H. M. , Tuovinen, O. H. , Puhakka, J. A. , Plumb, J. J. , on heavy metal-bearing phases. J. Hazard Mater. 187, 534-543. https:/doi. org/ Kaksonen, A. H. , 2010. Acid bioleaching of solid waste materials from copper, steel 10. 1016/jhazmat. 2011. 01. 070. and recycling industries. Hydrometallurgy 103, 74-79. [URL] Werner, A. , Meschke, K. , Bohlke, K. , Daus, B. , Haseneder, R. , Repke, J. -U. , 2018. hydromet. 2010. 02. 017. Resource recovery from low-grade ore deposits and mining residuals by Wakeman, K. , Auvinen, H. , Johnson, D. B. , 2008. Microbiological and geochemical biohydrometallurgy and membrane technology. Potentials and case studies. dynamics in simulated-heap leaching of a polymetallic sulfide ore. Biotechnol. Chem Bio Eng Rev 5, 6-17. [URL] Bioeng. 101, 739-750. [URL] Zhu, W. , Chen, X. , Struble, L. J. ,Yang, E. H. , 2018. Characterization of calcium-containing Wang, Q. , Yang, J, Wang, Q. , Wu, T, 2009. Effects of water-washing pretreatment on phases in alkali-activated municipal solid waste incineration bottom ash binder bioleaching of heavy metals from municipal solid waste incinerator fly ash. through chemical extraction and deconvoluted Fourier transform infrared spectra. J. Hazard Mater. 162, 812-818. [URL] J. Clean. Prod. 192, 782-789. [URL]
14 This work Tm(III) B. subtilis EFKYOJLp dry powder (EFKYOJLp powder) 33. 11 0. 56 This work Tm(III) Silicagel modified with diglycol amic acid 24. 5 6. 86 a22 Tm(III) Nano Vsized Ti O 2 24. 83 V 27 Dy(III) E-coli 32. 7 V 25 Dy(III) Diglycolic amic acid Vmodified E. coli 70. 2 0. 0392 25 Yb(III) Di(2Vthylhexly)phosphoric acid immobilized m agnetic GMZ bentonite 57. 8 0. 31 20 Lu(III) E. coli 42. 7 V 25 Lu(III) Diglycolic amic acid Vmodified E. coli 70. 5 0. 0494 25 a K L (L/mmol). Adsorbate Adsorbent Langmuir constants Page 33 of 34 ACS Paragon Plus Environment ACS Applied Materials & Interfaces 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 34 Table of Content Graphic Wild type Batillussabtillis 168 strain ∆LTA strain High flocculating activity ∆WTA strain High selectivity EFKYOJLp strain High adsorption capacity & High selectivity Defect of lipoteichoic acid Defect of wall teichoic acid Genetically Vengineering Defect of cell wall V digesting enzyme Adsorption of rare earth metal ions Sterilization / freezed Vdrying Sterilization / freezed Vdrying Sterilization / freezed Vdrying Page 34 of 34 ACS Paragon Plus Environment ACS Applied Materials & Interfaces 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60
masc. adj. philos ) friend, loving; N. L. masc. adj. sulfuriphilus sulfur-loving, referring to its ability to grow only using reduced forms of sulfur). Strain CJ-2 forms circular white colonies on solid medium. Straight, motile, flagellated and fimbriated rods (1. 5 –2. 5 µm long and 0. 5 µm wide), does not form endospores, stains Gram-negative. Obligate chemolitho-autotroph, uses zero- valent sulfur and reduced inorganic sulfur anions as elec- tron donors. Strict aerobe, uses only molecular oxygen as electron acceptor. Mesophilic and acid-tolerant; the opti- mum growth p H is approximately 3. 0 (minimum p H value for growth is 1. 8) and optimum growth temperature is 25–28/C14C. The type strain, CJ-2T(=DSM 105150T=KCTC 4683T) was isolated from an adit draining a former lead mine located in Wales (UK). The only other isolate belonging to this novel species was isolated from mine tailings in China, and clones of the species have been detected in geothermal and hydro- thermal habitats. The G+C content of the chromosomal DNA of the type strain is 61. 5 mol%. The Gen Bank/EMBL/ DDBJ accession numbers of strain CJ-2Tare MK193868 and RIZI01000000. Funding information C. F. and D. B. J. : This work was funded by the Natural Environment Research Council, UK (Grant reference NE/L014076/1). A. M. B. , M. C. and R. Q. : This work was supported by the Comisión Nacional de Inves- tigación Científica y Tecnológica (under Grants FONDECYT 1181251 to R. Q. , Programa de Apoyo a Centros con Financiamiento Basal AFB170004 to R. Q. , CONICYT-PFCHA/Doctorado Nacional/20171049 to A. M. B. ) and by Millennium Science Initiative, Ministry of Economy,Development and Tourism of Chile (under Grant ‘Millennium Nucleus in the Biology of the Intestinal Microbiota ’to A. M. B. , M. C. and R. Q. ). Conflicts of interest The authors declare that there are no conflicts of interest. References 1. Waksman SA, Joffe JS. Microörganisms concerned in the oxida- tion of sulfur in the soil. J Bacteriol 1922;7:239 –256. 2. Kelly DP, Wood AP. Reclassification of some species of Thiobacil- lusto the newly designated genera Acidithiobacillus gen. nov. , Hal- othiobacillus gen. nov. and Thermithiobacillus gen. nov. Int J Syst Evol Microbiol 2000;50:511 –516. 3. Hallberg KB, Lindström EB. Characterization of Thiobacillus caldus sp. nov. , a moderately thermophilic acidophile. Microbiology 1994; 140 :3451 –3456. 4. Mykytczuk NC, Trevors JT, Ferroni GD, Leduc LG. Cytoplasmic membrane fluidity and fatty acid composition of Acidithiobacillus ferrooxidans in response to p H stress. Extremophiles 2010;14:427 – 441. 5. Hallberg KB, Gonz /C19alez-Toril E, Johnson DB. Acidithiobacillus ferri- vorans , sp. nov. ; facultatively anaerobic, psychrotolerant iron-, and sulfur-oxidizing acidophiles isolated from metal mine-impacted environments. Extremophiles 2010;14:9 –19. 6. Hedrich S, Johnson DB. Acidithiobacillus ferridurans sp. nov. , an acidophilic iron-, sulfur- and hydrogen-metabolizing chemolitho- trophic gammaproteobacterium. Int J Syst Evol Microbiol 2013;63: 4018–4025. 7. Falag/C19an C, Johnson DB. Acidithiobacillus ferriphilus sp. nov. , a fac- ultatively anaerobic iron- and sulfur-metabolizing extreme acido- phile. Int J Syst Evol Microbiol 2016;66:206 –211. 8. Temple KL, Colmer AR. The autotrophic oxidation of iron by a new bacterium, Thiobacillus ferrooxidans. J Bacteriol 1951;62:605 –611. 9. Bryant RD, Mc Groarty KM, Costerton JW, Laishley EJ. Isolation and characterization of a new acidophilic Thiobacillus species ( T. albertis ). Can J Microbiol 1983;29:1159 –1170. 10. Hedrich S, Johnson DB. Aerobic and anaerobic oxidation of hydro- gen by acidophilic bacteria. FEMS Microbiol Lett 2013;349:n/a –45. 11. Amouric A, Brochier-Armanet C, Johnson DB, Bonnefoy V, Hallberg KB. Phylogenetic and genetic variation among Fe(II)-oxi- dizing acidithiobacilli supports the view that these comprise multi- ple species with different ferrous iron oxidation pathways. Microbiology 2011;157:111 –122. 12. Nuñez H, Moya-Beltr /C19an A, Covarrubias PC, Issotta F, C /C19ardenas JP et al. Molecular systematics of the genus Acidithiobacillus : Insights into the phylogenetic structure and diversification of the taxon. Front Microbiol 2017;8:30. Table 3. Minimum inhibitory concentrations and maximum concentrations (in parenthesis) at which growth was detected for CJ-2Tand other acidithiobacilli [1 –5, 33]. Metals were provided as sulfate salts. All concentrations are given in m M. ND,no data. Initial p H Fe (II) Fe(III) Zn Cu Mg SO 4 Na Cl CJ-2T4. 0 >500* 500 (300) 300 (200) 50 (25) 700 (500) 500 (300) A. caldus T1. 8 ND >34 >99 >23 ND 685 (513) † A. thiooxidans T3. 0 500 (300) >500 1000 (700) 10 (5) 1000 (700) 800 (500) ‡ A. ferrooxidans T2. 0 400 (200) 400 (200) 1000 (800) 500 (400) 1000 (800) 500 (250) ‡ A. ferridurans T2. 0 600 (400) 300 (200) 1000 (800) 300 (200) 1200 (1000) 800 (700) ‡ A. ferrivorans T2. 0 400 (200) <100 300 (200) <50 1000 (800) ND A. ferriphilus T1. 8–2. 0 1000 (900) 500 (300) 800 (700) 500 (300) 1000 (900) 500 (250) *Higher concentration prevented cell counting as iron precipitates at p H (4. 0) of the media used. †The initial p H of the media used was 2. 5. ‡The initial p H of the media used was 3. 0. Falag/C19anet al. ,Int J Syst Evol Microbiol 2019;69:2907 –2913 13. Johnson DB. Selective solid media for isolating and enumerating acidophilic bacteria. J Microbiol Methods 1995;23:205 –218. 14. Ňancucheo I, Rowe OF, Hedrich S, Johnson DB. Solid and liquid media for isolating and cultivating acidophilic and acid-tolerant sulfate-reducing bacteria. FEMS Microbiol Lett 2016;363:fnw083. 15. Nieto PA, Covarrubias PC, Jedlicki E, Holmes DS, Quatrini R. Selection and evaluation of reference genes for improved interro- gation of microbial transcriptomes: case study with the extremo- phile Acidithiobacillus ferrooxidans. BMC Mol Biol 2009;10:63. 16. Castro M, Moya-Beltr /C19an A, Covarrubias PC, Gonzalez M, Cardenas JPet al. Draft genome sequence of the type strain of the sulfur- oxidizing acidophile, Acidithiobacillus albertensis (DSM 14366). Stand Genomic Sci 2017;12:77. 17. Katoh K, Standley DM. MAFFT multiple sequence alignment soft- ware version 7: improvements in performance and usability. Mol Biol Evol 2013;30:772 –780. 18. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406 –425. 19. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci USA 2004;101:11030 –11035. 20. Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likeli- hood phylogenies. Mol Biol Evol 2015;32:268 –274. 21
Provided that each individ- ual maxout unit may have arbitrarily many aﬃne com- ponents, we show that a maxout model with just two hidden units can approximate, arbitrarily well, any Maxout Networks -4 -2 0 2 4 6 Activation05101520253035# of occurrences Histogram of maxout responses Figure 2. The activations of maxout units are not sparse. h2h1gz2,·z1,·v W1=1W2=−1 Figure 3. An MLP containing two maxout units can arbi- trarily approximate any continuous function. The weights in the ﬁnal layer can set gto be the diﬀerence of h1andh2. Ifz1and z2are allowed to have arbitrarily high cardinal- ity,h1and h2can approximate any convex function. gcan thus approximate any continuous function due to being a diﬀerence of approximations of arbitrary convex functions. continuous function of v∈Rn. A diagram illustrating the basic idea of the proof is presented in Fig. 3. Consider the continuous piecewise linear (PWL) func- tiong(v) consisting of klocally aﬃne regions on Rn. Proposition 4. 1 (From Theorem 2. 1 in (Wang, 2004)) For any positive integers mandn, there exist two groups of n+ 1-dimensional real-valued parame- ter vectors [W1j,b1j],j∈[1,k]and[W2j,b2j],j∈[1,k] such that: g(v) =h1(v)−h2(v) (1) That is, any continuous PWL function can be ex- pressed as a diﬀerence of two convex PWL functions. The proof is given in (Wang, 2004). Proposition 4. 2 From the Stone-Weierstrass ap- proximation theorem , let Cbe a compact domain C⊂Rn,f:C→Rbe a continuous function, and /epsilon1>0be any positive real number. Then there exists a continuous PWL function g, (depending upon /epsilon1), such that for all v∈C,\|f(v)−g(v)\|</epsilon1. Theorem 4. 3 Universal approximator theorem. Any continuous function fcan be approximated arbitrar- ily well on a compact domain C⊂Rnby a maxout network with two maxout hidden units. Table 1. Test set misclassiﬁcation rates for the best meth- ods on the permutation invariant MNIST dataset. Only methods that are regularized by modeling the input distri- bution outperform the maxout MLP. Method Test error Rectifier MLP + dropout (Sri- vastava, 2013)1. 05% DBM (Salakhutdinov & Hin- ton, 2009)0. 95% Maxout MLP + dropout 0. 94% MP-DBM (Goodfellow et al. , 2013)0. 91% Deep Convex Network (Yu & Deng, 2011)0. 83% Manifold Tangent Classifier (Rifai et al. , 2011)0. 81% DBM + dropout (Hinton et al. , 2012)0. 79% Sketch of Proof By Proposition 4. 2, any continuous function can be approximated arbitrarily well (up to /epsilon1), by a piecewise linear function. We now note that the representation of piecewise linear functions given in Proposition 4. 1 exactly matches a maxout network with two hidden units h1(v) andh2(v), with suﬃ- ciently large kto achieve the desired degree of approx- imation/epsilon1. Combining these, we conclude that a two hidden unit maxout network can approximate any con- tinuous function f(v) arbitrarily well on the compact domain C. In general as /epsilon1→0, we have k→∞. Figure 4. Example ﬁlters learned by a maxout MLP trained with dropout on MNIST. Each row contains the ﬁlters whose responses are pooled to form a maxout unit. 5. Benchmark results We evaluated the maxout model on four benchmark datasets and set the state of the art on all of them. Maxout Networks Table 2. Test set misclassiﬁcation rates for the best meth- ods on the general MNIST dataset, excluding methods that augment the training data. Method Test error 2-layer CNN+2-layer NN (Jar- rett et al. , 2009)0. 53% Stochastic pooling (Zeiler & Fergus, 2013)0. 47% Conv. maxout + dropout 0. 45% 5. 1. MNIST The MNIST (Le Cun et al. , 1998) dataset consists of 28 ×28 pixel greyscale images of handwritten digits 0-9, with 60,000 training and 10,000 test examples. For the permutation invariant version of the MNIST task, only methods unaware of the 2D structure of the data are permitted. For this task, we trained a model consist- ing of two densely connected maxout layers followed by a softmax layer. We regularized the model with dropout and by imposing a constraint on the norm of each weight vector, as in (Srebro & Shraibman, 2005). Apart from the maxout units, this is the same archi- tecture used by Hinton et al. (2012). We selected the hyperparameters by minimizing the error on a valida- tion set consisting of the last 10,000 training examples. To make use of the full training set, we recorded the value of the log likelihood on the ﬁrst 50,000 exam- ples at the point of minimal validation error. We then continued training on the full 60,000 example train- ing set until the validation set log likelihood matched this number. We obtained a test set error of 0. 94%, which is the best result we are aware of that does not use unsupervised pretraining. We summarize the best published results on permutation invariant MNIST in Table 1. We also considered the MNIST dataset without the permutation invariance restriction. In this case, we used three convolutional maxout hidden layers (with spatial max pooling on top of the maxout layers) fol- lowed by a densely connected softmax layer. We were able to rapidly explore hyperparameter space thanks to the extremely fast GPU convolution library devel- oped by Krizhevsky et al. (2012). We obtained a test set error rate of 0. 45%, which sets a new state of the art in this category. (It is possible to get better results on MNIST by augmenting the dataset with transfor- mations of the standard set of images (Ciresan et al. , 2010) ) A summary of the best methods on the general MNIST dataset is provided in Table 2. Table 3. Test set misclassiﬁcation rates for the best meth- ods on the CIFAR-10 dataset. Method Test error Stochastic pooling (Zeiler & Fergus, 2013)15. 13% CNN + Spearmint (Snoek et al. , 2012)14. 98% Conv. maxout + dropout 11. 68 % CNN + Spearmint + data aug- mentation (Snoek et al. , 2012)9. 50 % Conv. maxout + dropout + data augmentation9. 38 % 5. 2. CIFAR-10 The CIFAR-10 dataset (Krizhevsky & Hinton, 2009) consists of 32×32 color images drawn from 10 classes split into 50,000 train and 10,000 test images. We pre- process the data using global contrast normalization and ZCA whitening. We follow a similar procedure as with the MNIST dataset, with one change. On MNIST, we ﬁnd the best number of training epochs in terms of validation set error, then record the training set log likelihood and continue training using the entire training set un- til the validation set log likelihood has reached this value. On CIFAR-10, continuing training in this fash- ion is infeasible because the ﬁnal value of the learn- ing rate is very small and the validation set error is very high. Training until the validation set likelihood matches the cross-validated value of the training like- lihood would thus take prohibitively long. Instead, we retrain the model from scratch, and stop when the new likelihood matches the old one. Our best model consists of three convolutional maxout layers, a fully connected maxout layer, and a fully con- nected softmax layer. Using this approach we obtain a test set error of 11. 68%, which improves upon the state of the art by over two percentage points. (If we do not train on the validation set, we obtain a test set error of 13. 2%, which also improves over the previous state of the art). If we additionally augment the data with translations and horizontal reﬂections, we obtain the absolute state of the art on this task at 9. 35% error. In this case, the likelihood during the retrain never reaches the likelihood from the validation run, so we retrain for the same number of epochs as the valida- tion run. A summary of the best CIFAR-10 methods is provided in Table 3. Maxout Networks 0. 0 0. 2 0. 4 0. 6 0. 8 1. 0 1. 2 # examples ×1070. 10. 20. 30. 40. 50. 60. 70. 80
Allteam methods are in gray while BLAST methods are in red, BLAST computational methods are in blue, and expression are in yellow, see Table 3 for the description of the baselines Consortium Genome Biology (2019) 20:244 Page 13 of 23 evidence codes, and the most common organism to have experimental annotations. Drosophila melanogaster had annotations was P. aeruginosa, on which our screen was the most annotated proteins of long-term memory with performed (Additional file 1: Table S2). 217, while human has 7, as shown in Additional file 1: As expected, mutants defective in the flagellum or its Table S3. motor were defective in motility (fli C and other fli and We performed RNAi experiments in Drosophila flg genes). For some of the genes that were expected, but melanogaster to assess whether 29 target genes were asso- not detected, the annotation was based on the experi- ciated with long-term memory (GO:0007616). Briefly, ments performed in a medium different from what was flies were exposed to wasps, which triggers a behavior used in these assays. For example, Pho B regulates motil- that causes females to lay fewer eggs. The acute response ity but only when phosphate concentration is low [44]. is measured until 24 h post-exposure, and the long-term Among the genes that were scored as defective in motility, response is measured at 24 to 48 h post-exposure. RNAi some are known to have decreased motility due to over was used to interfere with the expression of the 29 target production of carbohydrate matrix material (bif A) [45], or genes in the mushroom body, a region of the fly brain the absence of directional swimming due to absence of associated with memory. Using this assay, we identified 3 chemotaxis functions (e. g. , che W, che A) and others likely genes involved in the perception of wasp exposure and 12 showed this phenotype because of a medium-specific genes involved in the long-term memory. For details on requirement such as biotin (bio A, bio C, and bio D) [46]. the target selection and fly assay, see [29]. None of the 29 Table 2 shows the contingency table for the number of genes had an existing annotation in the GOA database. proteins that are detected by our experiment versus GOA Because no genome-wide screen results were available, annotations. we did not release this as part of the CAFA-πT and instead The results from this evaluation were consistent with relied only on the transfer of methods that predicted the what we observed for biofilm formation. Many of the "long-term memory" at least once in D. melanogaster genes annotated as being involved in biofilm formation from CAFA3. Results from this assessment were more were identified in the screen. Others that were annotated promising than our findings from the genome-wide as being involved in biofilm formation did not show up in screens in microbes (Fig. 10). Certain methods performed the screen because the strain background used here, strain well, substantially exceeding the baselines. PA14, uses the exopolysaccharide matrix carbohydrate Pel [47] in contrast to the Psl carbohydrate used by another Participation growth well-characterized strain, strain PAO1 [48, 49]. The psl The CAFA challenge has seen growth in participation, genes were known to be dispensable for biofilm formation as shown in Fig. 11. To cope with the increasingly large in the strain PA14 background, and this nuance highlights data size, CAFA3 utilized the Synapse [50] online plat- the need for more information to be taken into account form for submission. Synapse allowed for easier access when making predictions. for participants, as well as easier data collection for the The CAFA-πT methods outperformed our BLAST-based organizers. The results were also released to the individ- baselines but failed to outperform the expression-based ual teams via this online platform. During the submission baselines. Transferred methods from CAFA3 also did process, the online platform also allows for customized not outperform these baselines. It is important to note format checkers to ensure the quality of the submission. this consistency across terms, reinforcing the finding that term-centric prediction of biological processes is likely to Methods require non-sequence information to be included. Benchmark collection In CAFA3, we adopted the same benchmark generation Long-term memory in D. melanogaster methods as CAFA1 and CAFA2, with a similar timeline Prior to our experiments, there were 1901 annota- (Fig. 12). The crux of a time-delayed challenge is the tions made in the long-term memory, including 283 annotation growth period between time to and ti. All target proteins that have gained experimental annotation during this period are taken as benchmarks in all three Table 2 Number of proteins in Pseudomonas aeruginosa ontologies. “No knowledge” (NK, no prior experimental associated with function motility (GO:0001539) in the GOA annotations) and “Limited knowledge" (LK, partial prior databases versus experimental results experimental annotations) benchmarks were also distin- GOA annotations guished based on whether the newly gained experimental Total, 3630 Unannotated Annotated annotation is in an ontology that already have experimen- 3195 12 tal annotations or not. Evaluation results in Figs. 3 and False CAFA experiments 4 are made using the No knowledge benchmarks. Evalu- True 403 21 ation results on the Limited knowledge benchmarks are Consortium Genome Biology (2019) 20:244 Page 14 of 23 long-term memory in Drosophila 0. 8 0. 72 0. 72 0. 69 0. 6 0. 6 0. 51 0. 45 0. 43 0. 2 0. 0 Fig. 10 AUROC of top five teams in CAFA3. The best-performing model from each team is picked for the top five teams, regardless of whether that model is submitted as model 1. All team methods are in gray while BLAST methods are in red and BLAST computational methods are in blue, see Table 3 for the description of the baselines shown in Additional file 1: Figure S3. For more informa- more specific information about the actual function of a tion regarding NK and LK designations, please refer to the protein, and in many cases may indicate a non-functional, Additional file 1 and the CAFA2 paper [26]. non-specific binding. If it is the only annotation that a After collecting these benchmarks, we performed two protein has gained, then it is hardly an advance in our major deletions from the benchmark data. Upon inspect- understanding of that protein; therefore, we deleted these ing the taxonomic distribution of the benchmarks, we annotations from our benchmark set. Annotations with noticed a large number of new experimental annotations a depth of 3 make up almost half of all annotations in from Candida albicans. After consulting with Uni Prot- MFO before the removal (Additional file 1: Figure S15B). GOA, we determined these annotations have already After the removal, the most frequent annotations became existed in the Candida Genome Database long before 2018 of depth 5 (Additional file 1: Figure S15A). In BPO, the but were only recently migrated to GOA. Since these most frequent annotations are of depth 5 or more, indi- annotations were already in the public domain before cating a healthy increase of specific GO terms being the CAFA3 submission deadline, we have deleted any added to our annotation database. In CCO, however, most annotation from Candida albicans with an assigned date new annotations in our benchmark set are of depths prior to our CAFA3 submission deadline. Another major 3, 4, and 5 (Additional file 1: Figure S15). This differ- change is the deletion of any proteins with only a protein- ence could partially explain why the same computational binding (GO:0005515) annotation. Protein binding is a methods perform very differently in different ontologies highly generalized function description, does not provide and benchmark sets. We have also calculated the total 150 144 CAFA1 129 123 CAFA3 103 100 68 56 59 50 30 11 Teams Data Submitted (Methods) Models (GB) Fig. 11 CAFA participation has been growing. Each principal investigator is allowed to head multiple teams, but each member can only belong to one team. Each team can submit up to three models Consortium Genome Biology (2019) 20:244 Page 15 of 23 Preliminary Final Benchmark Benchmark t1 to Collection Collection Prediction June2017 November 2017 September2016 February 2017 owth CAFA3 Target Submission Release Deadline tla t1b Fig. 12 CAFA3 timeline information content per protein for the benchmark sets Tool (BLAST) software against the training database [52]. shown in Additional file 1: Figure S16. Taxonomic dis- A term will be predicted as the highest local align- tributions of the proteins in our final benchmark set are ment sequence identity among all BLAST hits annotated shown in Fig. 6. from the training database. Both of these methods were Additional analyses were performed to assess the char- trained on the experimentally annotated proteins and acteristics of the benchmark set, including the overall their sequences in Swiss-Prot [53] at time to. information content of the terms being annotated. Microbe screens Protein-centric evaluation To assess the matrix production, we used mutants from Two main evaluation metrics were used in CAFA3, the the PA14 NR collection [54]. Mutants were transferred Fmax and the Smin. The Fmax based on the precision-recall from the - - 80 °C freezer stock using a sterile 48-pin multi- curve (Fig. 3), while the Smin is based on the remain- prong device into 200 μl LB in a 96-well plate
70 H3K9ac K562 (1) 0. 87 0. 85 0. 85 0. 87 0. 86 0. 86 0. 87 0. 86 0. 87 0. 86 0. 86 0. 87 0. 87 0. 87 0. 87 H3K9me3 K562 (2) 0. 74 0. 77 0. 75 0. 84 0. 83 0. 83 0. 83 0. 78 0. 83 0. 84 0. 86 0. 86 0. 79 0. 80 0. 82 H3K4me1 K562 (3) 0. 65 0. 67 0. 65 0. 68 0. 67 0. 68 0. 67 0. 67 0. 71 0. 69 0. 67 0. 69 0. 67 0. 67 0. 69 H3K9ac K562 (4) 0. 74 0. 75 0. 70 0. 74 0. 73 0. 75 0. 74 0. 74 0. 77 0. 75 0. 75 0. 75 0. 74 0. 74 0. 75 H3K4me1 K562 (5) 0. 80 0. 80 0. 80 0. 81 0. 81 0. 81 0. 81 0. 80 0. 82 0. 81 0. 80 0. 81 0. 81 0. 81 0. 81 H3K36me3 K562 (6) 0. 63 0. 65 0. 62 0. 70 0. 70 0. 74 0. 71 0. 66 0. 70 0. 72 0. 73 0. 74 0. 65 0. 67 0. 69 H3K36me3 K562 (7) 0. 75 0. 77 0. 75 0. 78 0. 77 0. 79 0. 77 0. 77 0. 78 0. 78 0. 78 0. 79 0. 76 0. 77 0. 77 H4K20me1 K562 (8) 0. 62 0. 69 0. 69 0. 71 0. 69 0. 71 0. 69 0. 69 0. 72 0. 71 0. 70 0. 72 0. 69 0. 69 0. 71 Published as a conference paper at ICLR 2024 H3K27me3 K562 (9) 0. 74 0. 74 0. 75 0. 80 0. 79 0. 80 0. 80 0. 79 0. 80 0. 79 0. 80 0. 80 0. 78 0. 77 0. 80 H3K4me3 K562 (10) 0. 88 0. 89 0. 87 0. 89 0. 88 0. 89 0. 89 0. 89 0. 9 0. 89 0. 89 0. 89 0. 89 0. 89 0. 89 H3K4me3 K562 (11) 0. 89 0. 89 0. 87 0. 89 0. 89 0. 89 0. 89 0. 89 0. 9 0. 89 0. 89 0. 89 0. 89 0. 89 0. 89 H3K4me3 K562 (12) 0. 84 0. 85 0. 82 0. 85 0. 84 0. 85 0. 85 0. 84 0. 86 0. 85 0. 85 0. 85 0. 85 0. 85 0. 85 H3K4me3 K562 (13) 0. 76 0. 77 0. 72 0. 77 0. 75 0. 77 0. 76 0. 76 0. 80 0. 77 0. 77 0. 78 0. 76 0. 75 0. 77 H3K79me2 K562 (14) 0. 74 0. 76 0. 75 0. 76 0. 76 0. 76 0. 76 0. 75 0. 76 0. 76 0. 76 0. 77 0. 76 0. 70 0. 76 H3K4me2 K562 (15) 0. 70 0. 72 0. 67 0. 71 0. 70 0. 72 0. 71 0. 71 0. 75 0. 73 0. 71 0. 72 0. 70 0. 70 0. 72 H3K27ac K562 (16) 0. 70 0. 72 0. 67 0. 71 0. 70 0. 72 0. 70 0. 71 0. 76 0. 73 0. 71 0. 72 0. 71 0. 71 0. 72 H2AFZ K562 (17) 0. 70 0. 71 0. 67 0. 72 0. 71 0. 73 0. 71 0. 71 0. 75 0. 73 0. 73 0. 73 0. 70 0. 70 0. 72 Table A11: Cp G methylation prediction performance per cell line. Model SK-N-SH GM23248 A549 Hep G2 HUES64 GM23248 He La-S3 ENCFF567KCL ENCFF170XYJ ENCFF948WVD ENCFF690FNR ENCFF890GMD ENCFF840XVU ENCFF754RAW Basset 0. 93 0. 94 0. 93 0. 90 0. 95 0. 94 0. 93 CNN 0. 84 0. 84 0. 84 0. 82 0. 93 0. 84 0. 83 Res Net-LM 0. 86 0. 87 0. 86 0. 85 0. 94 0. 87 0. 86 A WD-LSTM 0. 80 0. 80 0. 80 0. 78 0. 89 0. 80 0. 79 NT-H 0. 87 0. 87 0. 87 0. 85 0. 94 0. 87 0. 87 NT-MS 0. 92 0. 92 0. 92 0. 89 0. 96 0. 92 0. 91 NT-1000G (2. 5B) 0. 88 0. 88 0. 88 0. 86 0. 94 0. 88 0. 87 NT-V2 0. 90 0. 91 0. 90 0. 88 0. 96 0. 91 0. 90 DNABERT 0. 91 0. 91 0. 91 0. 88 0. 96 0. 91 0. 90 DNABERT-2 0. 89 0. 89 0. 89 0. 87 0. 96 0. 89 0. 89 GENA-LM BERT 0. 91 0. 91 0. 91 0. 89 0. 95 0. 91 0. 90 GENA-LM Big Bird 0. 90 0. 91 0. 90 0. 88 0. 95 0. 91 0. 90 Hyena DNA tiny 0. 85 0. 85 0. 85 0. 83 0. 92 0. 85 0. 84 Hyena DNA large 0. 91 0. 91 0. 91 0. 88 0. 94 0. 91 0. 90 GROVER 0. 88 0. 89 0. 88 0. 86 0. 94 0. 89 0. 88 Table A12: Variant effect prediction performance (AUROC) on the expression variant effect pre- diction dataset, stratified by variant category. Categories that only have samples of one label were ommitted as no AUC can be determined. For completeness, also AUROCs on categories with very low sample numbers are reported, but should be interpreted with caution. Model Intron (n=60,072) Intergenic (n=23,218) Upstream gene (n=6,339) Downstream gene (n=4,581) Regulatory region (n=4,010) Noncoding transcript exon (n=3,099) 3’ UTR (n=2,025) 5’ UTR (n=462) TF binding site (n=433) Splice region (n=129) Splice polypyrimidine tract (n=103) Missense (n=60) Splice donor region (n=31) Synonymous (n=24) Splice donor (n=15) Splice donor 5th base (n=13) Stop lost (n=2) Deep SEA 0. 70 0. 69 0. 71 0. 71 0. 71 0. 68 0. 64 0. 72 0. 64 0. 55 0. 62 0. 72 0. 46 0. 54 0. 35 0. 83 1. 00 Res Net-LM 0. 55 0. 54 0. 56 0. 55 0. 52 0. 51 0. 54 0. 44 0. 46 0. 44 0. 54 0. 49 0. 69 0. 70 0. 50 0. 50 1. 00 A WD-LSTM 0. 53 0. 54 0. 52 0. 55 0. 56 0. 53 0. 51 0. 51 0. 51 0. 48 0. 51 0. 44 0. 31 0. 28 0. 38 0. 37 0. 00 NT-H 0. 55 0. 54 0. 54 0. 55 0. 52 0. 51 0. 49 0. 43 0. 44 0. 51 0. 33 0. 57 0. 36 0. 71 0. 50 0. 67 1. 00 NT-MS 0. 55 0. 53 0. 54 0. 55 0. 54 0. 55 0. 57 0. 48 0. 53 0. 54 0. 51 0. 54 0. 56 0. 65 0. 19 0. 60 1. 00 NT-1000G-2. 5B 0. 44 0. 43 0. 43 0. 44 0. 48 0. 46 0. 48 0. 44 0. 47 0. 42 0. 40 0. 44 0. 39 0. 54 0. 27 0. 21 1. 00 NT-1000G-500M 0. 49 0. 48 0. 49 0. 47 0. 50 0. 53 0. 50 0. 45 0. 51 0. 51 0. 48 0. 40 0. 66 0. 29 0. 46 0. 33 0
The MLA is a Scanning Electron (Rognes et al. , 2016). Minimum Entropy Decomposition was used to Microscope-based automated image analysis programme, which allows partition marker gene datasets of the remaining reads into operational quantitative mineralogical and textural data to be obtained. 3 g of each taxonomic units (OTUs). To assign taxonomic information to each OTU, sample was mixed with graphite powder and embedded in epoxy resin DC-MEGABLAST alignments of cluster representative sequences to the (25 mm). The original mounts were cut vertically, rotated at 90 °C, re- sequence reference database/dbdir/nt. ltered. fa (Release 13 February embedded into a second epoxy-resin and polished to obtain grain 2020) were performed. OTUs and taxonomic assignments were further mounts of 30 mm, which were then carbon-coated and measured by processed with the QIIME software package (version 1. 9. 1, [URL] MLA using the GXMAP measurement mode (Fandrich et al. , 2007). The ime. org/). Abundances of bacterial taxonomic units were normalized MLA system comprised of a field emission scanning electron microscope using lineage-specific copy numbers of the relevant marker genes to (FE-SEM) (FEI Quanta 650F) equipped with two energy-dispersive X-ray improve estimates (Angly et al. , 2014). (EDX) detectors (Bruker Quantax X-Flash 5030) and the MLA software suite version 3. 1. The MLA was operated at 25 k V (acceleration voltage), 2. 4. Bioleaching experiments and characterization of leaching residues 10 n A (probe current), 4. 78 spot size and horizontal frame width of 500 pixels. Particles were segmented into grains based on their back- Bioleaching of the waste rock (NC_01) and tailings (NC_02) were scattered electron intensity, and X-ray spectra were then collected to carried out at room temperature, and 5 wt% pulp density in 250 m L characterize the identified phases. Minerals/phases present were clas- shake flasks continuously agitated at 160 rpm, using 20 % (v/v) inoc- sified by matching the measured spectra to a mineral reference list. ulum from an acidophilic culture containing 10. cells/m L. The same Table A1 shows the mineral compositions of the two mine wastes, which nutrient medium used to culture the consortium (in section 2. 3) was also were mainly composed of silicate (e. g. quartz) and sulfide (e. g. pyrite) used for the bioleaching experiments. For each mine waste sample, one- minerals. step and two-step bioleaching studies were conducted. In one-step bio- leaching (1s B), the acidophilic consortium was inoculated into the 2. 3. Cultivation and biomolecular analysis of the bioleaching microbial nutrient medium containing the mine waste samples. To investigate consortium whether the contents of the mine waste samples were toxic to the growth and leaching capacity of the acidophilic consortium, a two-step bio- The novel acidophilic, mesophilic, microbial consortium used here leaching approach was additionally applied. In two-step bioleaching was obtained from Brandenburg University of Technology Cottbus, (2SB), biomass growth was initially separated from leaching by allowing Germany. Prior to the bioleaching experiments, the consortium was the acidophilic consortium to grow for 7 days before the addition of the grown at room temperature, with continuous agitation at 120 rpm in mine waste samples. This approach has been reported to reduce the toxic shake flasks containing filter-sterilized basal salts (g/L: Na2SO4-10H2O effects of solid materials on microorganisms (Brandl et al. , 2001; Horeh 7. 5, (NH4)2SO4 22. 5, KCl 2. 5, Mg SO4-7H2O 25, KH2PO4 2. 5, Ca et al. , 2016). (NO3)2:4H2O 0. 7, Zn SO4. 7H20 0. 5) at p H 1. 8, supplemented with 300 No indigenous microorganisms were found (microscopically and by m M ferrous sulfate. To determine the genera/phylum/kingdom of the DNA extraction) in the mine waste samples, therefore there was little or organisms in the consortium, DNA extraction was performed using the no activity of such organisms in this study. There were two abiotic DNeasy. Power Soil@ Pro Kit according to the manufacturer's in- controls (AC) for each mine waste sample: Abiotic control 1 (AC -1) and structions. Creation of amplicon-based libraries and microbiome Abiotic control 2 (AC -2). In AC-1, the inoculum volume was replaced sequencing and profiling were performed at Eurofins Genomics Europe with an equal volume of nutrient medium (mine waste in nutrient me- C. B. Opara etal. Minerals Engineering188(2022)107831 dium) to represent abiotic leaching since no indigenous bacteria were inoculum and nutrient medium volumes were replaced with an equal found in the mine wastes. This was done to analyze the influence of the volume of deionized water (mine waste in deionized water). For all nutrient medium on the leaching of the samples. In AC-2, both the experiments, deionized water was added to compensate for evaporation 25 80 70 20 60 (%) 50 40 10 30 20 10 14 14 Time (days) Time (days) (a) (b) 90 100 80 90 70 80 ℃6 7 0 50 0 pa 50 40 30 3 0 20 20 10 10 14 21 14 Time (days) Time (days) (c) (d) 80 90 70 80 60 70 60 50 pa 40 40 eal 30 = 30 20 20 10 10 14 21 14 21 28 Time (days) Time (days) (e) (f) 18. 0 16. 0 50 12. 0 10. 0 30 8. 0 6. 0 4. 0 2. 0 14 21 14 Time (days) Time (days) (g) (h) Fig. 6. Metal(loid)s [Cu (a), Zn (b), As (c), Cd (d), Co (e), In (f) and Mn (g)] recovery (in %) from the Neves Corvo tailings (NC_02) by acidophilic consortium and evolution of total dissolved Fe (h), p H (i) and sulfate concentration (j) during the bioleaching experiment. Values are the average of duplicate flasks ± stan- dard deviations. C. B. Opara et al. Minerals Engineering 188(2022) 107831 o° 14 14 21 28 Time (days) Time (days) (i) (i) ne-stepbioleaching(1SB) -Abiotic control-1(NC_02+nutrient medit Abioticcontrol-2（NC_02+deionisedwater) Fig. 6. (continued). performance ion chromatography (Dionex Integrion, Thermo Scienti- Table 2 fic), and inductively coupled plasma mass spectrometry (ICP-MS) Maximum metal(loid) recovery efficiencies from NC_01 and NC_02 by acido- (Nex ION 350x, 1300 Watts, Argon plasma gas, Perkin Elmer), respec- philic consortium. tively. The percentage of metal(loid) solubilization after t days of in- Metal(loid) recovery (%) from Metal(loid) recovery (%) from cubation was calculated as follows: waste rock (NC_01) tailings (NC_02) Metal Ml -Mi One-step Two-step One-step Two-step % metal(loid)leached = X100 bioleaching (1) (loid)s bioleaching bioleaching bioleaching Mt Cu 32 (28 days) 33 (28 days) 21 (21 days) 21 (21 days) 73 (14 days) 73 (21 days) where Mt is the total mass (mg) of the element in the solid waste sample, Zn 86 (21 days) 80 (21 days) 80 (21 days) 78 (14 days) 85 (14 days) Mi is the mass (mg) of the element in the leachate at day t and M; is the As 82 (21 days) Cd 100 (21 days) 100 (14 days) 87 (14 days) 85 (14 days) initial mass (mg) of the element in the liquid nutrient medium. 97 (21 days) 87 (21 days) 69 (21 days) 73 (21 days) At the end of the bioleaching experiment, bioleached residues were 66 (21 days) In 67 (14 days) 71 (14 days) 77 (14 days) harvested, dried at room temperature and weighed. The chemical 55 (21 days) 47 (21 days) 62 (21 days) 60 (21 days) Mn 10 (21 days) 11 (28 days) compositions of the dried bioleached residues were analyzed by ICP-MS A1 8 (28 days) 15 (28 days) 4 (14 days) 4 (14 days) after acid digestion (HCl + HNO3 + HF, 1:3:1) in a microwave (Multi- Si 3 (14 days) 2 (28 days) wave 3000, Anton Paar Gmb H) at 240 °C and 800 W. The bioleached samples were analyzed for their mineral composition using XRD and using the weight difference method. All experiments were run in SEM/MLA-GXMAP at the same conditions stated in Section 2. 2
in addition to this, the manufacturing technology for the re- covery of metals depends upon these imported rare earth ele- Problems and challenges in recycling ments such as neodymium, lanthanum, yttrium, and cerium, which account for about 85% of the global production but electronic wastes recovery of these metals has some limitations due to technical problems (Isildar et al. 2018). Separating these REE materials One of the significant challenges in the recycling of electronic from the products in a tiny amount still poses challenges (Du waste is the very low quantity of REEs in each device. This and Graedel 2011). The most common methods used to re- may create the wrong idea that recovering REEs from WEEE cover REEs from WEEE include mechanical treatments, at a is not profitable. The recovery efficiency is low due to the lack pre-processing stage, and metallurgical treatments as main of an appropriate design (Wang et al. 2016). Profound re- processes for metals refining. Pyro- and hydrometallurgical search carried out in the past few decades for the recovery of technologies are energy and resource intensive and usually REEs from electronic wastes (e. g. , fluorescent lamps, Springer Environ Sci Pollut Res magnets, Ni MH batteries, mobile phones, and others) shows approach as well as to reduce its pollution (Yazici and that about 99% of REEs are recycled (Darnerud 2008; Deveci 2009; Priya and Hait 2018; Yamane et al. 2011). Marinkovic et al. 2010; Abdelouahab et al. 2011; Zhang One of the downsides of currently used pre-treatment tech- et al. 2015; Cucchiella et al. 2016; Furberg et al. 2019; Hsu nologies is the loss of critical elements, for instance, as shred- et al. 2019; Meng et al. 2019; Yoshida and Terazono 2010). ding dust (Sethurajan et al. 2019). Thus, optimization of the pre- Kell (2009) recovered REEs such as Nd, Pr, and Dy with- treatment stage is still needed to avoid the loss of the REEs out the involvement of non-REE from industrial scrap mag- during the recovery process (Oguchi et al. 2011). It is also nets and industrial Nd Fe B magnets using membrane-assisted necessary to integrate the pre-treatment process with chemical solvent extraction in 120-h run. Similar results have been re- and other physical methods for the energy recovery and removal ported by Khaliq et al. (2014) for electronic wastes. Some ofhazardous components (Marra et al. 2018) as shown in Fig. 1. electrical and chemical companies are integrated to develop Dismantling/manual disassembly is the process in which procedures and processes for the recovery of REEs having hazardous material and other streams are removed from the high purity and efficiency from electronic waste. It has also components of electronic wastes such as screens, batteries, ca- been reported that this mature process has impressive advan- pacitors, PCB, computers CPU and RAM for the selective re- tages such as low environmental footprint, which enhances covery of the REEs, and other high-value products (Lee et al. shorter lead time as well as a cheaper source when compared 2004). Moreover, in terms of process view, it allows separating with the primary production of the electronic material the metallic parts from the non-metallic elements, such as ce- (Stevens and Goosey 2008). ramics and plastics, to increase the overall potential of recycling Most of these approaches can be applied for the recycling in a circular economy context (Li et al. 2007). However, there of electronic wastes by using sorbents for solid-phase extrac- are some difficulties in separating and recovering REEs from the tion or liquid-liquid extraction processes in a column or batch different types of electronic waste due to high costs of automa- system (Jiang et al. 2012). Moreover, the recovery of these tion for the specific application, resulting in manual dismantling, elements from electronic wastes, such as metal alloys in mag- which makes this stage labor intensive (Kopacek 2016; nets, need special treatment than the above approaches. There Lindkvist et al. 2017; Park et al. 2015). To overcome this prob- is also a need to develop products recycling policy and other lem, there is an approach developed by Wang et al. (2012) networks that can assure quality, price efficiency of the sepa- called *Best-of two-Worlds" (Bo2W) which states that it is nec- ration, and recovery of REEs. It is also essential to develop essary to ingrate the manual sorting or dismantling with the strategies and for preserving REEs resources (Hanafi et al. automatic developed process for the efficient recovery technol- 2012; Jiang et al. 2012; Yao et al. 2018). In general, to develop ogies of the REEs from the electronic waste (Wang et al. 2012). novel and sustainable recycling techniques, some challenges need to be addressed in the future, to implement REEs recov- Mechanical pre-treatment process ery on a large scale (Dalrymple et al. 2007). The second step in the recovery of metals and other REEs from electronic waste is mechanical treatment. In this step, Recycling of electronic waste metals and other value products are separated and liberated using physical processes. They can be segregated by shape, Electronic wastes are complex because they contain oxides, size, weight, density, and magnetic and electrical characteris- metals, non-metals, and polymeric materials, rendering their tics to improve the technical and economic aspects of the separation and recovery very challenging. Details about recovery process (De Oliveira et al. 2012). For instance, WEEE recycling technologies are presented and discussed Kaya (2016) investigated the recovery of metals from waste below. printed circuit boards using physical and chemical processes. The researcher showed that hammering and shredding elec- Pre-treatment of electronic waste tronic waste reduced it to a suitable size, enhancing the effi- ciency of the recovery process (Kaya 2016). However, recent Pre-treatment is one of the first steps during WEEE recycling, research by Martino et al. (2017) showed that reduction of the involving disassembly or dismantling, physical separation, size and liberation using electrodynamic fragmentation is an and size reduction. During the recovery of metals and other unconventional process for the recovery of the metal due to REEs from electronic waste, selecting an appropriate technol- fine grinding (typically <200 mm) of the electronic waste ogy is challenging because these elements differ in their type, (Martino et al. 2017). metal content, and composition (Cui and Forssberg 2003; Other researchers (Ogunniyi et al. 2009; Yazici and Deveci Yazici and Deveci 2009; Yazici et al. 2015; Goosey and 2009; Yazici et al. 2010) have also reported a similar finding Goosey 2019). Thus, it is necessary to enhance the technical to recover metals from PCB. These studies show that if the efficiency of the recovery process with a material-centered size of the electronic waste is < 75 mm, it leads to trouble in Springer Environ Sci Pollut Res Fig. 1 Integrated pre-treatment methodology for WEEE WEEE Disassembly Chemical (acid) water De-soldering Solder Physical processing (Exp: pulverization) Physical separation Non metallic Metallic fraction fraction separation and liberation. Moreover, they claimed that getting Some physical separation approaches for the recovery of the required amount of the size reduction of the electronic metals from WEEE are shown in Table 1. waste can increase the liberation as well as the physical sepa- There is dire need to conduct more experimentation to in- ration of the metals from the electronic waste, before applying crease the recovery of metals with low impurities from elec- different extraction technologies. tronic waste and to assess the fate of the critical elements in the The main purpose of physical separation is to segregate the future (Duan et al. 2009; Galbraith and Devereux 2002; Guo materials and increase the benefit of WEEE based on their size, et al. 2011; Kumar et al. 2018; Ogunniyi and Vermaak 2009a; at a low price. Physical separation is based on differences in b). Duflou et al. (2008) show that automated disassembly is not conductivity, specific gravity, brittleness, hydrophobicity of the technically and economically feasible. Moreover, they claimed phases, and magnetic susceptibility (Veit et al. 2005; Wills and that using a general standard procedure for grinding electronic Finch 2015; Yazici and Deveci 2015). Magnetic separation, for waste can lead to loss of precious metals, which cannot be instance, can be applied to remove and separate ferrous metals recovered by refining or downstream process. They recom- from electronic waste, as a magnetic fraction as shown in Fig. 2 mended that the optimization of the manual disassembly pro- (Pant et al. 2012; Yazici and Deveci 2009). Air classification cess is needed during the pre-treatment (Duflou et al. 2008; can be used to separate fine plastics or fluffy material (Lee et al. Buchert et al. 2012). In another study by Zhang and Xu (2016), 2004; Zhao et al. 2012; Zhou and Qiu 2010). a mechanochemical method was used as pre-treatment for the Moreover, light metals which have high conductivity to recovery of metals
Environ Manage 144:1 Mrazikova A, Kadukova J, Marcincakova R, Velgosova O, Wilner J, Fornalczyk A, Received:6 December 2017 Accepted: 19 February 2018 Saternus M (2016) The effect of specific conditions on Cu, Ni, Zn and Al Published online: 22 February 2018 recovery from PCBS waste using acidophilic bacterial strains. Arch Metall Mater 61:261-264 Nie H, Yang C, Zhu N, Wu P, Zhang T, Zhang Y, Xing Y (2015) Isolation of Acidithiobacillus ferrooxidans strain Z1 and its mechanism of bioleaching Copper from waste printed circuit boards. J Chem Technol Biotechnol References Arshadi M, Mousavi SM (2014) Simultaneous recovery of Ni and Cu from 90:714-721 Pant D, Joshi D, Upreti MK, Kotnala RK (2012) Chemical and biological extra C- Computer-printed circuit boards using bioleaching: statistical evaluation tion of metals present in E waste: a hybrid technology. Waste Manage and optimization. Bioresour Technol 174:233-242 Arshadi M, Mousavi SM (2015) Multi-objective optimization of heavy metals 32:979-990 Priya A, Hait S (2017) Comparative assessment of metallurgical recovery of bioleaching from discarded mobile phone PCBs: simultaneous Cu and Ni recovery using Acidithiobacillus ferrooxidans. Sep Purif Technol metals from electronic waste with special emphasis on bioleaching. Environ Sci Pollut Res Int 24:6989-7008 147:210-219 Ballor NR, Nesbitt C, Lueking DR (2006) Recovery of scrap iron metal value Robinson BH (2009) E-waste: an assessment of global production and environ- using biogenerated ferric iron. Biotechnol Bioeng 93:1089-1094 mental impacts. Sci Total Environ 408:183-191 Bas AD, Deveci H,Yazici EY (2013) Bioleaching of copper from low grade scrap Rodrigues MLM, Leao VA, Gomes O, Lambert F, Bastin D, Gaydardzhiev S (2015) TV circuit boards using mesophilic bacteria. Hydrometallurgy 138:65-70 Copper extraction from coarsely ground printed circuit boards using Bryan CG,Watkin EL, Mc Credden T, Wong ZR,Harrison STL, Kaksonen AH moderate thermophilic bacteria in a rotating-drum reactor. Waste Man- age 41:148-158 (2015) The use of pyrite as a source of lixiviant in the bioleaching of Shah MB, Tipre DR, Purohit MS, Dave SR (2015) Development of two-step electronic waste. Hydrometallurgy 152:33-43 processfor enhanced biorecovery of Cu-Zn-Ni from computer printed Coram NJ, Rawlings DE (2002) Molecular relationship between two groups of circuit boards. J Biosci Bioeng 120:167-173 the genus Leptospirillum and the finding that Leptospirillum ferriphilum sp. nov. Dominates South African commercial biooxidation tanks that Silva RA, Park J, Lee E, Park J, Choi SQ, Kim H (2015) Influence of bacterial adhe- sion on copper extraction from printed circuit boards. Sep Purif Technol operate at 40 °C. Appl Environ Microbiol 68:838-845 Dopson M, Bakeraustin C, Koppineedi PR, Bond PL (2003) Growth in sulfdic 143:169-176 Tian J,Wu N, Li J, Liu Y, Guo J, Yao B, Fan Y (2007) Nickel-resistant determinant mineral environments: metal resistance mechanisms in acidophilic micro-organisms. Microbiology 149:1959 from Leptospirillum ferriphilum. Appl Environ Microbiol 73:2364-2368 Vestola EA, Kuusenaho MK, Narhi HM, Tuovinen OH, Puhakka JA, Plumb JJ, Kak- Erust C, Akcil A, Gahan CS, Tuncuk A, Deveci H (2013) Biohydrometallurgy of sonen AH (2010) Acid bioleaching of solid waste materialsfrom copper, secondary metal resources: a potential alternative approach for metal steel and recycling industries. Hydrometallurgy 103:74-79 recovery. J Chem Technol Biotechnol 88:2115-2132 Wang J, Bai J, Xu J, Liang B (2009) Bioleaching of metals from printed wire Hallmann R, Friedrich A, Koops HP, Pommerening-Roser A, Rohde K, Zenneck boards by Acidithiobacillusferrooxidans and Acidithiobacilus thiooxidans C, Sand W (1992) Physiological characteristics of and physicochemical and their mixture. J Hazard Mater 172:1100-1105 factors influence microbial metal leaching. Geomicrobiology 10:193-206 Xiang Y, Wu P, Zhu N, Zhang T, Liu W, Wu J, Li P (2010) Bioleaching of copper Hong Y,Valix M (2014) Bioleaching of electronic waste using acidophilic sulfur from waste printed circuit boards by bacterial consortium enriched from oxidising bacteria. J Clean Prod 65:465-472 acid mine drainage. J Hazard Mater 184:812-818 Ilyas S,J-C Lee (2014) Biometallurgical recovery of metals from waste electrical Yang T, Xu Z, Wen J, Yang L (2009) Factors influencing bioleaching copper from and electronic equipment: a review. Chem Bio Eng Rev 1:148-169 waste printed circuit boards by Acidithiobacillus ferrooxidans. Hydrometal- Ilyas S, J-C Lee, R-A Chi(2013) Bioleaching of metals from electronic scrap lurgy 97:29-32 and its potential for commercial exploitation. Hydrometallurgy Yang Y, Chen S, Li S, Chen M, Chen H, Liu B (2014) Bioleaching waste printed 131-132:138-143 Isildar A, van de Vossenberg J, Rene ER, van Hullebusch ED, Lens PNL (2016) circuit boards by Acidithiobacillus ferooxidans and its kinetics aspect. J Two-step bioleaching of copper and gold from discarded printed circuit Biotechnol 173:24-30 Zhu N, Xiang Y, Zhang T,Wu P, Dang Z, Li P,Wu J (2011) Bioleaching of metal boards (PCB). Waste Manage 57:149-157 Jadhav U, Hocheng H (2013) Extraction of silver from spent silver oxide-zinc concentrates of waste printed circuit boards by mixed culture of acido- button cells by using Acidithiobacillus ferrooxidans culture supernatant. J philic bacteria. J Hazard Mater 192:614-619 Clean Prod 44:39-44
Numerous investigations on the bioleaching of metals were lites via acidolysis, complexolysis, and alkalolysis for extraction of metals from WEEE (Cu, Zn, Ni, Pb, Sn, Al, La, Ce, Pr, Nd, carried out with wild cultures of A. thiooxidans, A. caldus, and Eu, Gd, Y, U etc. ). A. ferrooxidans. The description of L. ferrooxidans showed that Acidolysis is a dominant leaching mechanism that involves it was not as easily enriched as A. ferrooxidans from the sam the protonation of oxygen atoms in the metal compound. The ples containing both organisms. But the propensity of L. ferro protonated oxygen then combine with water, resulting in the oxidans to attach to sulfide minerals, its high affinity towards metal oxide being detached from the solid surface and being ferrous iron and low sensitivity to inhibit ferric ions compared solubilized [27]. The common acids secreted by heterotrophs to A. ferrooxidans, were the additional evidence of its increas- are lactic, oxalic, gluconic, acetic, citric, succinic, pyruvic, and ing importance in the bioleaching. The complete biooxidation formic acids [29, 35, 42]. These assist in creating a low p H envi of sulfide minerals or added energy source involves the oxida ronment which enhances the bioleaching of metals. Organic tion of both iron and sulfur. Iron-oxidizing bacteria produce ferric ions. Oxidation of metal sulfides is reported to occur acids produced and the proton-translocating ATPase of the through thiosulfate and the polysulfide pathways. The thio plasma membrane are the sources of protons, which decrease hrough thiosulfate nolysulfde nathwa the availability of anions to the cations in metal compounds, sulfate is oxidized to sulfuric acid biologically and/or chemi- thus causing the solubilization of metal ions [39, 42]. cally while elemental sulfur is produced through polysulfide While the organic acids formed from the heterotrophs par intermediates and the sulfur-oxidizing microorganisms such as ticipate in acidolysis, mechanism of complexolysis also takes A. thiooxidans and A. caldus reduce the accumulation of sulfur place because the organic acids, some of which are powerful efficiently, compared to A. ferrooxidans while improving the bi- natural chelating agents, form metallic complex with the metals oleaching efficiency [29-34]. With a view to improve the leaching efficiencies with en from the material to be bioleached [40]. The solubilization of metal ions is based on the complexing capacity of a molecule. hanced oxidation of sulfur and iron, studies were often con If the bonds between metal ions and ligands are stronger than ducted with consortia of microorganisms. Brandl et al. [35] re ported their preliminary investigation on the feasibility of the lattice bonds between metal ions and solid particles, the metal will be successfully leached out from the solid particles. In recovery of base metals from the dust of e-waste shredding most cases of metal leaching from solid wastes or electronic scrap with consortium of A. ferrooxidans and A. thiooxidans. The by heterotrophic microorganisms, the organic acids act as lixi leaching experiments showed that the addition of elevated viant (leaching agent) and directly solubilizes metals [41, 42]. amounts of scrap led to an increase of the initial p H due to the The enzymatic hydrolysis of urea or deamination of amino alkalinity of electronic scrap. In view of the alkalinity of the acids by microbes, when these compounds are used as the ener- electronic scrap and acid consumption at higher pulp density, gy source, results in the production of ammonia which is able and to reduce the toxic effects on the microbes, the biomass was produced in the first stage in the absence of electronic to leach metals by the alkalolysis process. This mechanism is scrap over a period of 7 days. Electronic scrap was subse very effective in mobilizing metals from silicates or aluminosili- quently added in different concentrations and the cultures were cates [41]. This mechanism enables bioleaching to take place at incubated for an additional period of 10 days in the second high p H values. stage. The consortium was able to leach more than 90 % of the available Al, Cu, Ni, and Zn. At higher concentration, metal 2. 2 Bioleaching of Heavy Metals from Waste mobilization was reduced, especially for Al and Cu. Ni and Zn Electrical and Electronic Equipment. showed much better results with mobilization of 60 % and 95 %, respectively (Fig. 3). In all cultures, Pb and Sn were not Among the acidophilic prokaryotes generally applied for biol- detected in the leachate. It is proposed that Pb precipitated as Pb SO4, and Sn precipitated probably as Sn O. Due to the pre eaching of heavy metals from WEEE, the mesophiles or moder- ately thermophiles exhibit optimum growth in the p H range of cipitation of the metals during the microbial leaching process, subsequent treatment of the leach residue is essential to recover 1. 5-2. 5. They can be classified into mesophiles (20-35C) or moderate thermophiles (40-55 C) on the basis of the tempera the metals already leached. The investigation by Choi et al. [47] ture range for their growth [34]. clearly shows a relation between the amount of copper dis. ture range for their growth [34] clearly shows a relation between the amount of copper dis Chem Bio Eng Rev 2014, 1, No. 4, 148-169154 www. Chem Bio Eng Rev. de 2014 WILEY-VCH Verlag Gmb H & Co. KGa A, Weinheim Chem Bio Eng eviews Wiley Online Library Ilyas et al. [2] used wild cultures, adapted cultures, and con 100 Al X sortium of moderately thermophilic bacteria such as Sulfobacil- ZZZZ Cu lus thermosulfidooxidans and an unidentified acidophilic heter- A Ni 80 otroph (code A1 TSB) isolated from the local environment to XXXI Zn % Metal mobilization leach metals from washed and unwashed electronic scrap. At a scrap (PCBs) concentration of 10 g L-', the metal adapted con- 60 sortium leached more than 89% Cu, 81% Ni, 79% Al, and 83 % Zn in 18 d in presence of 10 g L-' sulfur. The secreted car- boxylic acids, such as citric, oxalic, and succinic acids, from the 40 heterotroph was able to increase the leaching rate in this case which could be due to the synergistic effect of the heterotroph on the growth of S. thermosulfidooxidans (Fig. 4). 20 100 Cu A 90 N 5 10 50 100 80 Scrap concentration (gl-1) % 70 Metal Solubilized Figure 3. Mobilization of Al, Cu, Ni, and Zn from different con- 60 centrations of electronic scrap at 30 C in a two-step process 50 [35]. 40 solved in solution and that in the precipitate when Fe+ is. added in the leaching media. With 7 g L-' Fe2+, copper leaching 20 was 37 % by A. ferrooxidans from the shreds of PCBs. The ad 10 dition of citric acid as a complexing agent improved the copper leaching to 80 %. Further research by Yang et al. [50] correlated c E A B D the recovery of copper from WEEE, with p H, concentration of Figure 4. Percent metal solubilization after 18 d of bioleaching of Fe3+ in the medium, and the amount of bacterial inoculum electronic scrap (ES) under different conditions [2]. (A: Unwashed used. A 100% inoculum of A. ferrooxidans, pre-grown with ES with adapted cells of s. thermosulfidooxidans, B: washed ES 6. 66 g L-' Fe3+, leach 98 % Cu in 24 h at 1. 5 p H, whilst 72 % Cu with unadapted cells of S. thermosulfidooxidans, C: washed ES leaching was observed in absence of inocula under the same with adapted culture of s. thermosulfidooxidans, D: washed ES conditions. The adverse effect of increased pulp density on the with sulfur and adapted cells of S. thermosulfidooxidans, E: washed leaching of metals with a mixed culture of A. ferrooxidans and ES with adapted mixed culture of s. thermosulfidooxidans and A1TSB). Leptospirillum sp. were also observed by Vestola et al. [51]. Bio leaching in presence of 4. 5 g L-' Fe2+ and 10 g L-' S could pro- mote 100 % dissolution of Cu and Ni from the PCBs at 1. 5 p H A detailed study by Ilyas et al. [53], with an attempt to up. scale the process from shake flasks to lab scale column reactors, in 42 d at 1 % pulp density and the leaching rate dropped sub indicated that the effect of nonmetallic portion of scrap con- stantially, at 10 % pulp density under the same conditions. Fur ther studies by Bas et al. [52] suggested the potential of utiliza. tributes toward alkalinity can be minimized by washing treat- tion of pyrite as a suitable source of iron and sulfur during ment without the alteration of metals concentration
Figures 5aand5bgive the derived single-component spectra of Nd AAzo and Nd(AAzo) 2 together with their 68% conﬁdence limits (CI) as evaluated from the experimental data sets using TBCAT under the assumption that the absorption data and component concentrations are uncertain to the extents speciﬁed by Table 1. It is evident that the single-component spectrum of the minor 1:1 species Nd Aazo was estimated but has large uncertainties. No systematic trend with respect to the slightly chang- ing p H can be recognized. The single component spectrum at p H =3. 3( s e t B )s h o w sa major deviation with its absorption band at 551 nm. The major species Nd(AAzo) 2was estimated with much better consistency. The me- dian values for the molar absorption at 653 nm fall within 145,000 L ·mol−1·cm−1<ε max< 110,000 L·mol−1·cm−1. The 0. 68 percentiles, however, have a wider range and render the observed subtle effects (e. g. , the systematic decrease in molar absorption with increasing p H) insigniﬁcant. Figure 6summarizes the formation constants log 10β11of Nd AAzo and log 10β12of Nd(AAzo) 2. The box-and-whisker diagrams give median values and the 0. 68 J Solution Chem (2008) 37: 933–946 943 Fig. 5b Estimated single-component spectra of the species Nd(AAzo) 2for the four data sets A–D. The spectral curves are consistent for all four data sets. The median of the absorption curves decreases systematically with p H at the absorption maximum of 653 nm, but the decrease is much smaller than the 0. 68 percentile uncertainties ( dashed lines )a n d hence is insigniﬁcant Fig. 6 Comparison of formation constants log 10β11and log 10β12evaluated by TBCAT for the four data sets 944 J Solution Chem (2008) 37: 933–946 (the box) and 0. 95 (the whiskers) conﬁdence limits. The other symbols indicate the mean value, upper and lower 99% conﬁdence limit, and the maximum and minimum values from 1000 TBCAT resampling cycles. The median values for log 10β11are in the range 4. 9 to 6. 3 and for log 10β12range between 10. 5 and 12. 1. This span is not unusual if all relevant inﬂu- ence factors are taken into consideration. These uncertainties also indicate that claims in the literature that formation constants can be determined by UV-Vis absorption spectroscopy to the second decimal position must be rejected as vast over interpretation. There is, also, no systematic change in the distributions evaluated for the complete mea- surement uncertainty budget of the formation constants for the two species that might be attributed to the change in p H in going from set A (p H =3. 0) to set D (p H =3. 9). 4 Conclusions Arsenazo III (AAzo) is a widely applied organic complexant that has been used in the pho- tometric determination of metal ions [ 1,2] for almost 50 years. Despite its long-time use, some fundamental properties of this compound are poorly characterized. Next to the pro- tolysis constants [ 12], complexation studies with metal ions, e. g. , lanthanides [ 5,10,11], show discrepancies even as to the nature of the species that are present in solutions. Us- ing chemometric tools, e. g. , submatrix analysis [ 15], the complexity of the chemical system AAzo/Nd(III) can be assessed as being limited to three or four species. Using factor analysis as a model-free tool to evaluate the UV-Vis spectroscopic data, the formation of just a single 1:1 complex between AAzo and Nd(III) can be excluded. The system was only interpretable assuming the formation of both 1:1 and 1:2 complexes between AAzo and Nd(III). This con- clusion is in agreement with the conclusion of reference [ 7]. Reports that only a 1:1 species is formed [ 5,11] are mostly based on the observation of apparent isosbestic points, without further analysis of the detailed spectroscopic properties in the system under study. TBCAT analysis has shown that a numerically satisfactory description of this system is possible on basis of a 1:1 species. Closer analysis (i. e. , Fig. 2), however, leads to disagreements. Modeling of spectroscopic signals in terms of chemical species is always based on noise- affected data. It is the task of the researcher to ﬁnd a balance between over interpretation and underestimation of the reliability of the experimental data. Therefore, an interpretation of the numerical data should be based upon a prior assessment of the complete measurement uncertainty budget [ 18,19]. Then, the derived information can be judged relative to the total scatter in the values for the quantity of interest. The cause-and-effect approach allows con- tributions to the complete measurement uncertainty budget from different inﬂuence factors to be separated. In agreement with previous ﬁndings, this analysis has shown that correla- tion among parameters and correlation in spectral residuals [ 35] make the overwhelming contributions to these uncertainties. Hence, inﬂuence factors like the purity of chemicals contribute to the measurement uncertainty, but accounting for them cannot reduce the over- all uncertainty signiﬁcantly because the main contributions are from statistical effects. Of course, such statistical effects can only be quantiﬁed if they are in fact accounted for. Ran- domization, for instance, would destroy the correlation effects between spectral residuals. In the evaluation of the complete measurement uncertainty, contribution from these corre- lations would not appear despite affecting the evaluated quantity. Therefore, the threshold bootstrap method, a modiﬁcation of the moving block bootstrap approach, has been used instead of a random bootstrap scheme [ 35]. J Solution Chem (2008) 37: 933–946 945 Acknowledgements The authors wish to thank Dr Przemyslaw Niedzielski for his kind help in the de- termination of arsenic, using atomic absorption spectrometry (AAS) combined with the hydride generation. Partial ﬁnancial support of this work by the Medical University of Lodz (project 503-3014-2) to Dr Alek- sander Kufelnicki is kindly acknowledged. References 1. Savvin, S. B. : Analytical use of arsenazo III—Determination of thorium, zirconium, uranium and rare earth elements. Talanta 8, 673–685 (1961) 2. Singer, E. , Matucha, M. : Erfahrungen mit der Bestimmung von Uran in Erzen und Gesteinen mit Arse- nazo III. Fresenius Z. Anal. Chem. 191, 248–253 (1962) 3. Nemcova, I. , Metal, B. , Podlaha, J. : Dissociation constants of arsenazo III. Talanta 33, 841–842 (1986) 4. Rohwer, H. , Collier, N. , Hosten, E. : Spectrophotometric study of arsenazo III and its interactions with lanthanides. Anal. Chim. Acta 314, 219–223 (1995) 5. Rohwer, H. , Hosten, E. : p H dependence of the reactions of arsenazo III with the lanthanides. Anal. Chim. Acta 339, 271–277 (1997) 6. Lu, Y. W. , Keita, B. , Nadjo, L. : Rational approach of the stoichiometries of lanthanide complexes with α2-[P2W17O61]10−heteropolytungstate in aqueous solution. Polyhedron 23, 1579–1586 (2004) 7. Lu, Y. W. , Laurent, G. , Pereira, H. : Interactions between lanthanides and arsenazo III. Talanta 62, 959– 970 (2004) 8. Hosten, E. , Rohwer, H. E. : Complexation reactions of uranyl with arsenazo III. Anal. Chim. Acta 355, 95–100 (1997) 9. Meinrath, G. , V olke, P. , Helling, C. , Dudel, E. G. : Determination and interpretation of environmental wa- ter samples contaminated by uranium mining activities. Fresenius J. Anal. Chem. 364, 191–202 (1999) 10. Close, I. , Lännergren, J. I. : Arsenazo III calcium transients and latency relaxation in frog skeletal muscle ﬁbers at different sarcomere lengths. J. Physiol. 355, 323–344 (1984) 11. Rowatt, E. , Williams, R. J. P. : The interaction of cations with the dye arsenazo III. Biochem. J. 259, 295– 298 (1989) 12. Kufelnicki, A. , Lis, S. , Meinrath, G. : Application of cause-and-effect analysis to potentiometric titration. Anal. Bioanal. Chem. 382, 1652–1661 (2005) 13. Meinrath, G. , Schneider, P. : Quality Assurance in Chemistry and Environmental Science. Springer, Hei- delberg (2007), p. 218 14
Under conditions of iron 6Biosynthesis of siderophores deprivation, the fux of chorismate is directed away from Siderophore scaffolds require a degree of flexibility and yet the aromatic aminoacid synthesis and towards siderophore synthesis. For pyoverdins (40), it is suggested that the phenolic capability of coordinating iron(n), ideally in a hexadentate Published on 07 April 2010. Downloa. capability of synthesis. For pyoverdins (4. ) , it is suggested that the phenolic in a hexadentate coordinating iron(il), ldea OH Serine HC OH HO OH OBS (7) DBS (7) Fig. 9 The biosynthesis of enterobactin (8) on NRPS modules. See legend to Fig. 8 for identification of the modules. The Cy domain couples the amino acids and catalyses the cyclization and dehydration steps. R is the reducing domain. Based on Walsh and Marshall. 141. 652Nat. Prod. Rep. , 2010, 27, 637-657 This journal is The Royal Society of Chemistry 2010. View Article Online. chromophore is synthesised from tyrosine and diaminobutyrate, 0 probably as part of an NRPS-catalysed synthesis. HO NHOH CH3 Ac Co A Co AH Hydroxamate groups are most frequently located on ornithine or lysine side chains after acylation with formate, acetate, mesaconate or the C-terminus of a peptide. The amine oxygen- HN COH HN COH COH HN ation reaction is typically catalysed by monoxygenases. -Hydroxycarboxylate groups are either used preformed, as in Citric acid CH H COH the citrate molecule, or created by direct hydroxylation of aded by University of Missouri at Columbia on 23/05/2013 12:36:08. aspartate using dioxygenases. HNO OH 5-Membered heterocyclic groups typically result from the OH 36 Aerobactin cyclization of cysteine, serine or threonine side chains during COH HO siderophore synthesis on NRPS assemblies, producing thiazoline CONE 0 and oxazoline rings. Thiazoline rings are sometimes reduced to CH3 H CO,H thiazolidine rings, such conversion having a critical influence on. Fig. 10Biosynthesis of aerobactin via the Col V-K30 plasmid of E. coli. the stereochemistry of the molecule, for instance with pyochelin (25). These cyclisation and reduction steps are catalysed by NRPS auxiliary domains. 141 Cunninghamella elegans by supplementing the medium with analogues of 1,4-diaminobutane. 47 These are listed in 6. 2 Biosynthesis of phenol-containing siderophores Appendix 1 (88A-88E). Similar directed fermentation of Streptomyces olivaceus has led to the preparation of an Enterobactin (8) uses dihydroxybenzoic acid and serine as extensive range of ferrioxamine analogues, which are also listed building blocks (Fig. 9). The dihydroxybenzoic acid acts as an in Appendix 1 (17-22). 148 N-capping substrate for the NRPS and the assembly system forms ester links (instead of amide links) between the capped serine molecules. 140 6. 4Biosynthesis of phytosiderophores Mycobactin (1) is synthesised on a cluster of modular enzymes The phytosiderophores of graminaceous plants are without that are highly homologous to NRPSs, with the reacting acyl Published on 07 April 2010. Downloa that are highly homologous to NRPSs, with the reacting acyl exception all synthesised via nicotianamine (23). Three methio- functions also being covalently linked via thioesters. 142 Salicylate. nine residues are condensed via S-adenosyl-L-methionine (SAM) and threonine are coupled and cyclised to form hydroxy- by nicotianamine synthase. (Fig. 11). 149 Nicotianamine is ubiq- phenyloxazoline. This is then attached in sequence to an uitous amongst plants, while the enzymic steps involved in the N-acylated lysine and -hydroxybutyrate. A final condensation conversion of nicotianamine to deoxymugineic acid (22) appear step with a cyclised lysine unit generates the complete myco- to be an additional acquisition by graminaceous plants. Both the bactin backbone. The two oxime functions are generated on this enzymes involved with deoxymugineic acid synthesis (nicotian- precursor molecule. amine amino-transferase and deoxymugineic acid hydroxylase) Pyoverdin (40) synthesis occurs on a NRPS modular system are inducible under iron-deficient conditions. 150,151 where the peptides and the peptide precursor of the chromophore are produced in a step-wise manner. 143 The formation of the. chromophore, L/D isomerisation and both aminoacid and peptide NH2 Me cyclisation are all catalysed by auxiliary modules. 144 S-Adenosylmethionine COH Methionine 6. 3 Biosynthesis of hydroxamate-containing siderophores COH COH H-O3 Adenosyl A number of major hydroxamate siderophore classes are syn- NH2 H H CHg thesised on enzyme modular systems (XIRPS); for instance, * coprogen (3) and fusarines' incorporate ornithine and anhy- dromevalonic acid, while ferrichromes incorporate ornithine, COH COH COH glycine and sometimes serine. 74,14 Exochelins are synthesised on. Nicotianamine23 NH ZI NRPS systems, and with this class no racemisation or cyclisation steps are involved, just acylation and amide oxidation. 141 In contrast to the biosynthetic routes so far described, many COOH COOH COOH COOH COOH COOH citrate-containing siderophores are produced by NRPS-inde- 1 OH OH H pendent siderophore pathways (NISs),146 for instance aero- H H bactin (36). 141 The synthetic steps in these processes are 22 Avenic acid 9 relatively straightforward, and in the case of aerobactin, lysine is oxidised and then coupled to citrate (Fig. 10). The amide COOH COOH COOH bond formation occurs via an acyl-adenylate intermediate. Relatively simple synthetic schemes of this type lend themselves `OH Mugineic acid H OH HO to directed fermentation. Thus in the case of rhizoferrin. todirected. fermentation. Thus in the case of rhizoferrin large number of analogues have been produced by Fig. 11 Biosynthesis of phytosiderophores a This journal is The Royal Society of Chemistry 2010. Nat. Prod. Rep. , 2010, 27, 637-657653 View Article Online. 7 Siderophore-based antibiotics and pharmaceuticals N-CHz 7. 1 Siderophore-based antibiotics: Sideromycins HO HC HO OH COHS Sideromycins are antibiotics covalently attached to siderophores. OH CONH CONH CONH HN CONH They are actively transported into bacteria, which has the effect OH OH 43 of lowering the minimal inhibitory concentration of the antibi- otic by more than 100-fold. 152 Sideromycins were discovered Albomycin 81 X=0 aded by University of Missouri at Columbia on 23/05/2013 12:36:08. Albomycin c X = NH simultaneously with hydroxamate siderophores, ferrimycin being 0 Albomycin 82 X= first reported in 1960, when isolated from Streptomyces griseo- `NH2 N' flavus. 14,153 Ferrimycin A (42) consists of ferrioxamine B linked, via a bridging aminohydroxybenzoic acid, to an iminoester- substituted lactam. 154,15s Ferrimycins are only effective against -lactam antibiotics. An enormous range of such conjugates has Gram-positive bacteria. Salmycin A* is related to ferrimycin in been synthesised,165-167 coupled to hexadentate (46), tetradentate that it is based on a ferrioxamine backbone, but attached to an (47) and even bidentate iron(m) ligands (48). In a study of growth aminodisaccharide. 156 The closely related compounds danomy- curves of E. coli, it is clear that whereas the tris-hydroxamate (46) cins A and B and succinimycin also contain a ferrioxamine has a minimal influence on growth, the dicatecholato conjugate backbone linked to disaccharide moieties. 157 In similar fashion to (47) is more effective and the combined treatment even more ferrimycin, all these antibiotics exclusively inhibit Gram-positive so. 162 The mutants which eventually did grow lacked both the bacteria, and gain access to cells via the ferrioxamine B transport system. 152 iron H3NO spacer Drug siderophore HC *NH HO 44 -0 HO CH3 NH HN CH3 HN HO = HO 0 Published on 07 April 2010. Downloa OF 45 42 Albomycin (43) is iron-containing antibiotic, which is produced by a range of Streptomyces species. It was initially reported as grisein in 1947,ss,uss the structure being finally. elucidated in 1982159 and shown to consist of a linear tetrapeptide. OH attached to a thionucleoside. Albomycin possesses a broad spectrum of antibiotic activity, with MIC levels of 5 ng ml-' in many Gram-negative organisms. 152 Albomycin gains entry to. cells via the ferrichrome transporter
Analysis of the 16S r RNA gene used the complete ies with solid media used ferrous iron overlay plates (John- sequence (MN733279) retrieved from the genome using son and Hallberg 2007). For solid medium anaerobic growth, BARNAP (BAsic Rapid Ribosomal RNA Predictor ver- oxygen was removed from sealed incubation jars containing sion 0. 9-dev). This gene was 100% identical to the 16S activated carbon (Anaero Gen system, Fisher, U. K). r RNA gene sequence originally deposited in Gen Bank (MG062778) after the initial single colony isolation. The Phenotype and chemotaxonomy observations phylogeny of strain MG was assessed from the small sub- unit ribosomal RNA gene sequences alignment (MAFFT For scanning electron microscopy, cells were grown in v7. 229) (Katoh and Standley 2013), after manual trim- basal salts/trace elements medium (Nancucheo et al. 2016) ming and masking (> 50%). Phylogenetic trees were Springer Extremophiles reconstructed with two different algorithms (Neighbor- Phylogeny and genomic comparisons Joining and Maximum-Likelihood; Falagan et al. 2019) and their topologies compared. The consensus tree was Phylogenetic analysis of the 16S r RNA gene sequences constructed using PHYLIP (Shimada and Nishida 2017). placed strain MG outside the clade grouping the other iron-oxidizing members of the genus (Fig. 1) suggesting it represents an ancestral phylotype of iron-oxidizing aci- dithiobacilli, phylotype 3A of Nunez et al. (2017). Limited Results and discussion disagreement in topology was observed between trees built using Neighbour-Joining and Maximum-Likelihood meth- Isolation and distribution ods (Supplementary Fig. S2). Comparison of the sequences of strain MG and type strains of the genus Acidithiobacillus Strain MG was isolated from sediment of an acidic pond revealed identity differences (Table 2) which fall above the (approximately 12 m² surface area) close to the geother- proposed species level cut-off value of > 1. 3% (Stackebrandt mal site at Kalamos on the South coast of the island of and Ebers 2006), except in the case of A. ferriphilus and Milos, Greece (Supplementary Fig. S1). The water was at A. ferridurans for which the difference is marginally within ambient temperature, lightly coloured green from growth this cut-off value. Four distinct clades comprising isolates of unicellular algae, and was p H 3. 5. There were patches of the four previously named ferrous iron-oxidizing species of land surface in the area that were more acidic at about and a fifth for strain MG were also seen in re-construction of p H 2. The water was essentially chloride-free and con- phylogenetic trees of two (rec A and atp D) marker genes pre- tained 5 mg 1-1 ferrous iron. Ferrous iron oxidation was viously used (Amouric et al. 2011) to illustrate the genetic observed in a ferrous iron enrichment culture (p H 2) of diversity of A. ferrooxidans-like isolates (Supplementary sediment from the pond margin and ferric iron-encrusted Fig. S3). Genomic relatedness indices further supported colonies were readily obtained on Phytagel-solidified differentiation of strain MG from the named iron-oxidizing medium containing 25 m M ferrous iron at p H 2. All colo- Acidithiobacillus species. Pairwise comparisons between nies were of similar appearance and size. Identical 16S strain MG and the available reference genomes (Table 3) r RNA gene sequences were obtained from the two of the gave values, in both cases, well below the established thresh- colonies that were examined. Two closely related iron- olds used for prokaryotic species delimitation. A DNA:DNA oxidizing acidithiobacilli have been isolated from sites hybridization of about 35% for strain MG against A. fer- in China and similar bacteria from other mine-impacted rooxidans (using digoxigenin nucleic acid labelling and environments in China and the USA have been indicated chemiluminescence detection) suggested a similar diver- by highly similar 16S r RNA gene sequences (between 98 gence between the type strains of these species to those of and 99% identity to that of strain MG; Table 1). These the type strains of A. ferrooxidans from A. ferrivorans and isolates, clones and isolate MG could represent strains of A. ferriphilus (L. Laigle and P. Norris, unpublished data). the same species. Table 1 Origins of isolates and Gen Bank acc. no. clones with 16S r RNA gene sequences which have greater Isolates than 99. 6% identity to that of LMT1 Mine tailings, Lechang, China; AM502930 strain MG p H 1. 9 (Tan et al. 2008) Ish-01 Soil, China EU158322 Clones Fe-K6-C12 Mine tailings, Klondykee Mill, USA; EF612430 p H 5. 7 (Méndez et al. 2008) K6-C79 Mine tailings, Klondykee Mill, USA; EF612421 p H 5. 7 (Méndez et al. 2008) AMD-A14 Jinkouling tailings pond, Tongling, China; p H 2. 65 (Yang KC620596 et al. 2014) AMD-D35 Shuimuchong tailings pond, Tongling, China; p H 2. 1 KC620779 (Yang et al. 2014) G28 Yunfu sulfide mine, Guangdong, China; DQ480479 p H 2. 5 (He et al. 2007) X18 Copper sulfide ore bioleaching heap, China FJ268717 Springer Extremophiles Fig. 1 Consensus phylogenetic A. ferrooxidans ATCC 23270T (AF465604) tree derived from the 16S r RNA gene sequences showing the A. ferridurans ATCC33020T (NR_108138) relationship of strain MG with the type strains of the spe- cies with valid names of the A. ferrivorans NO-37T(NR_114620) genus Acidithiobacillus and Thermithiobacillus, the only A. ferriphilus M20T(NR_147744) other known genus in the Class. The gammaproteobacterium strain MG(MN733279) 100 Methylococcus capsulatus ACM 3302 was used as outgroup. A. albertensis DSM 14366T (NR_028982) Bootstrap values are indicated at the respective nodes in the 90 100 consensus tree derived from A. thiooxidans ATCC 19377T (NR_115265) ML, NJ and BI phylogenetic 100 treeing algorithms. Scale bar: A. sulfuriphilus CJ-2T(MK193868) 0. 07% sequence divergence A. caldus ATCC51756T (Z29975) Thermithiobacillustepidarius DSM 3134T(NR_042145) Acidithiobacilia class Methyloc capsulatus ACM3302(X72771) Gammaproteobacteria class Table 2 Identities of the strain MG 16S r RNA gene to those of Aci- Table 3 Genomic relatedness indexes (%) calculated between strain dithiobacillus type strains (from alignment of the regions between MG and acidithiobacilli reference strains nucleotide coordinates 31 and 1488; sequences recovered from Accession no. Strain d DDHa ANIbb ANImb Gen Bank(nr) and Ref Seq databases) Accession number Species % Identity WNJL01 Strain MG DSM 100. 00 100. 00 100. 00 107098T MN7332799; MG062778 Strain MG 100. 00 NC_015942 A. ferrivorans SS3 25. 00 81. 28 85. 57 NR_147744 Acidithiobacillus ferriphilus T 98. 87 LVXZ01 A. ferriphilus BY0502 25. 40 81. 07 85. 56 NR_108138 Acidithiobacilus feridurans T 98. 86 NC_011761 A. ferro-oxidans ATCC 24. 60 80. 93 85. 57 AF465604 Acidithiobacillus ferroox- 98. 56 23270T idans T NZ_AP018795 5A. ferridurans 24. 30 80. 37 85. 23 NR_114620 Acidithiobacillus ferrivorans T 98. 31 JCM18981 NR_028982 Acidithiobacilus albertensis T 98. 13 RIZI01 A. sulfuriphilus DSM 21. 80 74. 75 86. 20 NR_115265 Acidithiobacillus thiooxidans T 97. 11 105150T Acidithiobacillus sulfuriphi- AFOH01 A. thiooxidans ATCC KX426303 97. 14 19. 80 74. 24 84. 82 lus T 19377T Z29975 Acidithiobacillus caldus T 95. 63 MOAD01 A. albertensis DSM 20. 20 74. 27 83. 62 14366T a16S r RNA gene sequence retrieved from the MG strain genome CO005986 A. caldus ATCC 51756T 19. 00 72. 81 86. 56 using BARNAP (BAsic Rapid Ribosomal RNA Predictor version O. 9- AUIS01 T. tepidarius DSM 19
2 2 2 2 2 2 O 0 1 0 1 1 0 0 14 14 7 7 0 14 time [d] time [d] time [d] , filled symbols: relative mass-concentration of REE; - -, open symbols: p H-value. Control with media and microorganism, control with media and FP, O. sample with media, microorganism and FP. Graphs are averages of 6 to 17 measurements each. K. x. L. c. Y. I. organic acid concentration organic acid concentration organic acid concentration 4 4 [100mmol/l] [100mmol/l] 3 2 0 0 * 0 14 7 14 0 7 14 0 7 0 time [d] time [d] time [d]. overall c OOH (K. x. and Y. gluconic acid (K. x. ),. tataric acid (K. x. ), -. l. , in case of L. c. identical with lactic acid measurements), -. (iso)citric acid (K. x. , Y. l. ), -. lactic acid (L. c. ). Control with media and microorganism, O. sample with media, microorganism and FP. Graphs are averages of 6 to 17 measurements each. K. x. Y. I. L. c. p025 25 solved dyes [%] 20 20 15 15 15 10 10 5 5 5 0 0 0 14 14 7 14 0 7 0 0 time [d] time [d] time [d] Fig. 3c. Calculated relative mass concentration of bioleached REE-containing triband dyes in supernatant during direct leaching of FP with K. xylinus, L. casei, and Y. lipolytica. Legend: O. YOE,. Ba Si Os:Eu2+,. BAM,. LAP, X. CBT,. CAT. Phosphate of the growth medium might interact and precipitate Figs. 3a, b, and c show the results of the direct leaching approach using K. xylinus, L. casei, and Y. lipolytica, respectively. with dissolved REE (Maes et al. , 2017). Therefore phosphate was removed from the medium of Y. lipolytica as described by Brisson For all three strains, the concentration of dissolved REE increased during the whole leaching time (Fig. 3a). The highest release of. et al. (2016) and Shin et al. (2015) for bioleaching of monazite. In REE was observed for K. xylinus with 12. 6%, followed by Y. lipolytica this case, the yeasts have to cover their phosphorous needs from (10. 6%), and L. casei (6. 1%). Comparison with control experiments FP (Shin et al. , 2015). In our experiments the REE release after prove that this release is mainly caused by microbial activity two weeks was much lower than in the approaches with added whereas the media has only little effect on mobilization (up to phosphate (7. 7% or 9. 7% in case of potassium phosphate substi- 1. 1% in case of L. casei medium). In case of K. xylinus and Y. lipolytica tuted by potassium or potassium chloride compared to 10. 6% in only small amounts of REE were mobilized during the first three case of potassium phosphate containing medium). Therefore, all only small amounts of REE were mobilized during the first three case of potassium phosphate containing medium). ' Ihererore,al days. In contrast, in case of L. casei the REE were dissolved over further experiments were done with phosphate containing the whole period of time. In case of Y. lipolytica, the leaching rate medium. In case of all three strains, REE release was accompanied by a decreased after 7 days. In case of K. xylinus and L. casei no saturation was visible after 14 days. decrease of p H in the media. In the first three or seven days the S. Hopfe et al. /Waste Management 79 (2018) 554-563 559 S_y. I. S_K. x. S_L. c. : 8 % r 8 12 7 7 12 12 7 [%] [%] p H-value solved REE [ p H-value 6 10 10 10 solved REE [ 6 9 so\|ved REE [ ue T 5 p H-valu 8 5 8 8 5 9 9 4 4 9 4 4 3 4 3 3 4 2 2 2 2 2 2 1 0 1 0 0 1 7 14 7 7 14 0 0 14 0 time [d] time [d] time [d] Fig. 4a. Relative mass-concentration of REE and p H-value in supernatant during indirect leaching of FP with spent culture broth of a two weeks lasting cultivation with K. xylinus, L. casei, and Y. lipolytica. Legend: , filled symbols: relative mass-concentration of REE; - ,open symbols: p H-value. control with media and FP, O. sample with spent culture broth and FP. Graphs are averages of 4 to 8 measurements each. S_K. x. S_L. c. S_y. I. 0025 25 25 [%] solved dyes solved dyes 20 20 15 15 15 solved 10 10 10 5 5 5 ** 0 14 14 14 0 0 time [d] time [d] time [d] Fig. 4b. Calculated relative mass concentration of bioleached REE-containing triband dyes in supernatant during indirect leaching of FP with spent culture broth of a two weeks lasting cultivation with K. xylinus, L. casei, and Y. lipolytica. Legend: O. YOE,. Ba Si Os:Eu2+,. BAM,. LAP, X. CBT, X. CAT. p H-value decreased in case of all three strains, afterwards it was leaching rates. Accordingly, YOE was leached by K. xylinus with the highest amount (27. 5%), followed by Y. lipolytica (23. 5%), and nearly constant. After two weeks, approaches with Y. lipolytica L. casei (11. 5%). In the approaches with K. xylinus and Y. lipolytica showed the lowest p H (with p H 2. 5), followed by K. xylinus (with also Ba Si Os:Eu2+ was leached. The leaching rate was low during p H 2. 7), and L. casei (with p H 4. 1), although REE release was the highest in case of K. xylinus. Apparently, leaching effect depended the first days and increased up to the end of observation period. The overall leaching yield of Ba Si,Os:Eu2+ after two weeks was also from other factors than just the H*-concentration. All strains were selected due to their ability to produce organic with 10. 7% resp. 11. 7% much smaller than that of YOE. In case of. acids. It is obvious that the decrease of p H is related to the Y. lipolytica, minor amounts of BAM were leached as well. All other production of organic acids affecting also the mobilization of REE. dyes were nearly not dissolved. Experiments with pure La PO4 and pure YO3 confirm these results. After two weeks, less than 0. 015% Therefore the production of organic acids was investigated in more detail and the production of organic acids was confirmed in all of La were released from La PO4 in all cases. In contrast much larger three cases (Fig. 3b). The production rates corresponded the amounts of Y were released from YO3 (K. xylinus: 2. 8%, L. casei: growth rates of the respective microorganisms. The type of pro- 1. 6%, Y. lipolytica: 3. 5%). Y. lipolytica was used for additional leach- duced organic acid was strain dependent. K. xylinus produced ing experiments of single fluorescent dyes. After two weeks 7. 0% of. (iso)citric, gluconic, and in smaller amounts, also tartaric acid, YOE and 1. 3% of HP were mobilized, but only 0. 2% of LAP and less whereas L. casei and Y. lipolytica produced only lactic or (iso)citric than O. 01% of CBT and CAT (Fig. 5). Accordingly, the calculation acid, respectively. The overall co OH-concentration was calculated results seem to be reliable. as the number of coo H-groups per mole organic acid. The highest K. xylinus produces bacterial cellulose during growth resulting c OOH-amount was observed in case of Y. lipolytica (437. 0 mmol/l), in the incorporation of FP particles in the cellulosic pellicle. There-. fore, FP particles are more difficult to access by the microbial showing also the lowest p H after two weeks of incubation. Inter- estingly, in case of K. xylinus and Y. lipolytica, the amount of pro- metabolites. In order to investigate the biotic effects of bioleaching on duced organic acids was much higher in case of the samples containing FP than the amount in case of the controls without FP bioleaching efficiency, the FP was incubated with the cell-free supernatants of spent broth cultures (indirect bioleaching). The (K. xylinus: 240. 4 mmol/l resp. 85. 1 mmol/l, Y. lipolytica: 437. 0 mmol/l resp. 94. 1 mmol/l)
Ccs is composed of a 46 k Da β sub- kinase (PK) and phosphofructo kinase (PFK) allowed us unit and a 36 k Da α subunit. Ccl is a single polypeptide to predict that in L. ferriphilum, the Embden-Meyerhof- protein of 30 k Da. Parnas (EMP) pathway also works preferentially in the anabolic direction. Interestingly, in A. ferrooxidans and A. Inspection of the L. ferriphilum DSM 17947 genome thiooxidans which use the CBB cycle to fix CO2, genomic revealed the presence of ccs AB and ccl, but not acl AB, sug- analysis revealed the presence of genes for both PK and gesting that in this bacterium, citrate cleavage occurs via PFK (PFK-2) enzymes. This suggests that in both Acidithio- two successive reactions catalyzed by the enzymes Ccs and bacillus strains, the EMP pathway operates in both ana- Ccl, as described for the Aquifex and Hydrogenobacter gen- bolic and catabolic directions, wherein the 3- era and for H. thermophilus [54,55]. In addition, the pre- phosphoglyceraldehyde (PGA) formed by the CBB cycle dicted polypeptide sequences of Ccs A, Ccs B and Ccl enters the EMP pathway to form glucose via anabolic reac- displayed high amino acid similarity to the corresponding tions, or to form pyruvate via catabolic reactions. An proteins of H. thermophilus (Ccs A: 74% similarity, Ccs B: incomplete TCA cycle can convert pyruvate to oxaloace- 75% similarity and Ccl: 66% similarity). tate as well as to succinyl-Co A and 2-oxoglutarate to form metabolites related to the biosynthesis of cellular compo- Pyruvate ferredoxin oxidoreductase (POR) is another key nents [62]. Hypothetical models delineating the reactions enzyme in the RTCA pathway and catalyzes the reductive associated with the glycolytic/glucogenic pathway and the carboxylation of acetyl-Co A to pyruvate (Figure 1, reac- TCA coupled cycles in the Acidithiobacillus and Leptospiril- tion 10). POR, like OGOR, is a member of the 2-oxoacid lum strains examined in this study are shown in Figure 3. oxidoreductase family and both enzymes are structurally similar, making sequence comparisons difficult; fortu- Our genomic analysis suggests that completely different nately, the POR and OGOR enzymes of H. thermophilus regulatory mechanisms exist for microorganisms that fix have been enzymatically characterized [56-59], and the CO2 via alternative mechanisms. Specifically, the amino acid sequences are available in the NCBI database. Acidithiobacillus and Leptospirillum strains examined in this We identified five putative por genes (por ABGED) in the L. study fix CO2 by altering the direction of the central car- ferriphilum genome, and based upon the similarity of their bon metabolism. deduced amino acid sequences to those from H. ther- mophilus we assigned a putative function to these genes. Molecular mechanisms involved in CO2 concentrating The predicted proteins Por A, Por B, Por G, Por E and Por D mechanisms were similar (65-79%) to α, β, Y, & and & subunits of the Carbon concentrating mechanisms are present in many POR enzyme from H. thermophilus and has the conserved species of chemolithoautotrophic bacteria, enabling them pattern of 2-oxoacid: acceptor oxidoreductases (Prosite to grow in the presence of low concentrations of CO2. database). Additionally, the POR subunit genes were clus- They mainly utilize bicarbonate transporters and CO2 tered downstream of the for operon (Figure 2). traps to generate high intracellular concentrations of dis- solved inorganic carbon. Pyruvate produced from the RTCA cycle is directed to glu- coneogenesis (Figure 1) for the biosynthesis of several car- Inorganic carbon transporters that deliver intracellular bonated intermediate molecules required by the cell. The HCO3 - represent an important carbon concentrating anabolic conversion of pyruvate to phosphoenolpyruvate mechanism within a diverse group of microorganisms (PEP) is typically catalyzed by phosphoenolpyruvate syn- [63]. In cyanobacteria at least five distinct enzymes for thetase (PEPS), whereas the catabolic conversion of PEP active inorganic carbon uptake have been described, to pyruvate is catalyzed by pyruvate kinase (PK). The com- including BCT1 (High affinity Bicarbonate Transporter 1), bined and coordinated action of PEPS and PK allows the Sbt A (Sodium bicarbonate transporter A), Bic A (Low cell to control the interconversion of pyruvate and phos- affinity Nat-dependent Bicarbonate Transporter), NDH- phoenolpyruvate according to its metabolic requirements. 14 and NDH-13 (NAD(P)H dehydrogenase type 1) Additionally, in several organisms including bacteria and (Reviewed in [64]). Bic A is a Na+-dependent HCO3 - trans- archaea, phosphoenolpyruvate diquinase (PPDK) has porter belonging to the widespread Sul P (Sulphate Trans- been reported for interconversion of these metabolites porter or Permease) family [65]. In the Acidithiobacillus [60,61] A search of the L. ferriphilum DSM 17947 genome DSM 16786 and DSM 17318 strains analyzed in this revealed a candidate gene encoding PEPs, but did not work, a putative gene for the Bic A transporter was identi- uncover any genes encoding PK or PPDK. An additional fied, whereas in L. ferriphilum putative genes for the BCT1 search for genes involved in glycolytic pathways revealed transporter (cmp ABCD) were detected. that pfk A and pfk B, genes encoding the catabolic regula- Page 7 of 19 (page number not for citation purposes) BMCGenomics2008,9:581 [URL] A B CBB Cycle PE Incomplete TCA Reductive TCA Biosynthesis Biosynthesis Biosynthesis Biosynthesis Figure 3 Proposed models of the metabolic direction of the Embden-Meyerhof-Parnas (EMP) and TCA cycle pathways in the three microorganisms examined in this study. A) Model representing the pathways utilized by L. ferriphilum DSM 17947. PK, pyruvate kinase (EC 2. 7. 1. 40); PEPS, phosphoenolpyruvate syntethase (EC 2. 7. 9. 2); PC, pyruvate carboxylase (6. 4. 1. 1); PEPC, phosphoenolpyruvate carboxylase (4. 1. 1. 3. 1); POR, pyruvate ferredoxin oxidoreductase (1. 2. 7. 1); PDH, pyru- vate dehydrogenase (EC I. 2. 4. 1. ); CS, citrate synthase (EC2. 3. 3. 1). B) Model representing the pathways utilized by A. ferrooxi- dans DSM I6786 and A. thiooxidans DSM 17318. In A. ferrooxidans, the A, B and G subunits of the Por enzyme (encoded by por ABG genes) do not have amino acid identity with those from L. ferriphilum. In addition, por genes from L. ferriphilum DSM 17947 were not detected in either A. ferrooxidans DSM 16786 or A. thiooxidans DSM 17318. The carboxysome is a polyhedral micro compartment strains are followed by the cbb QO genes, which are located in the cytoplasm of most autotrophic bacteria and involved in posttranslational regulation of Rubisco. Car- is surrounded by a proteinaceous monolayer that report- bonic anhydrases are classified in four main forms: α-CA, edly contains Rubisco and carbonic anhydrase (CA) [63]. β-CA, -CA and ε-CA [67-69]. ε-CA has been described as CA converts accumulated cytosolic HCO3 - into CO2 a novel form that corresponds to carboxysomal shell pro- within the carboxysome, elevating the CO2 concentration tein Cso S3 [70]. The β-CA family is comprised of enzymes in the vicinity of Rubisco [65]. Previous reports described from four evolutionarily distinct clades (A through D). the A. ferrooxidans ATCC 23270 carboxysome as being Candidate genes for β-CA (Clade B), -CA and ε-CA, but composed of at least seven peptides, all encoded by genes not for α-CA, were identified in the A. ferrooxidans DSM located in a carboxysome operon [66]. Similarly, seven 16786 genome. This is consistent with that reported for A. candidate genes potentially involved in carboxysome for- ferrooxidans ATCC 23270 [6]. In A. thiooxidans DSM17318, mation were identified immediately downstream of the we only identified a single candidate gene for e-CA, cbb LS1 genes in both Acidithiobacillus strains examined in located in the putative carboxisome gene cluster. In L. fer- the present report
Figure 7 shows the transition of cell states while positive and negative data are being processed by the trained model. LSTM networks in this paper consist of 10 hidden nodes, so for each sequence and structure they are presented as a heat Map. The top parts of (A) and (B) show the cell states related to the sequence, and the bottom shows the cell states related to the structure. In the top red boxes, intensity differences exist between nucleotides (A,U) and (G,C). Since nucleotide pairs of A-U and G-C make hy- drogen bonds that have a great inﬂuence on the structure of mi RNA sequences, differences in the LSTM cell states can be understood as one of the successfully learned struc- tural features. In the bottom red boxes of Figure 7A, most boundaries between the continuous dots (loop/bulge) and the continuous brackets (stem) are clearly distinguishable by the LSTM cell states. However, in the bottom red boxes of Figure 7B, the left side of the backward strand shows different patterns. This is because the corresponding part belongs to the additional loop that deforms the palindromic structure, so it can also be understood as another learned feature to identify negative data. The notable aspect is that hidden nodes with almost no change are observed in both A. hsa-mir-4654 Homo sapiens mi R-4654 stem-loop (positive data) Forward strand Backward strand5’ 3’ CUGGCUGGUUGUGGGAUCUGGAGGCAUCUGGGGUUGGAAUGUGACCCCAGUCUCCUUUUCCCUCAUCAUCUGCCAG (((((. (((((. ((((. )))))))))))))). )))). )). ))). ))))) ((((((. ((((((((. Forward strand Backward strand5’ 3’ AGGAGACUGAGGCUCAGUGAAGUUAGGUAACUCCUUCAUAGUAGCAUGCCAGAGUGAAGAUGCAAACCUCAGACCUGGUUCUCCAAUGUUCCU. (((((((((((. ((((((. ((. )). )))))). ((((. )))). )))))). ))))). Sequence Structure Sequence Structure1 3 56 8 10 3 5 7 9 3 5 7 9 1 3 56 8 10B. Pseudo precursor mi RNA (negative data)time direction Figure 7. The transition of LSTM cell states related sequence and structural information for a positive (A) and a negative data sample (B) sequence and structure. These nodes can be understood as uninﬂuential ones and can be used to decide the appropriate number of nodes. 5. Discussion As mentioned above, our proposed method has the clear advantage of not requiring hand-crafted features. From the engineering point of view, producing good performance is more important than the meaning of the used features. However, from the biology point of view, the meaning of the used features is also important since they are crucial in understanding the biological mechanisms. In biology, us- ing a “black-box” approach whose internals cannot be in- terpreted is discouraged, and the visualization of cell states and activation according to time can be helpful for avoiding such a black-box situation. In this paper, we suggested a vi- sualization method for high-level features of sequence sec- ondary structures. Furthermore, if intuitive low-level fea- tures can be visualized, we believe that new features can also be discovered therefrom. Since the RNAfold tool also provides computed results of images when producing the secondary structure of input RNA, it seems natural to use them in the mi RNA pre- cursor prediction as well. In this work, although details are not covered, we have applied convolutional neural net- works (CNNs) which are widely used for analyzing image data. However, we only observed accuracy degradation by using CNNs, while the training time greatly increased. Because images contain more information including those contained in the dot-bracket notation, the utilization of im- ages will eventually be helpful for further performance im- provements, albeit the negative preliminary result. For fu- ture modiﬁcations, we believe that more sophisticated pre- processing techniques and model compositions to reﬂect mi RNA secondary structure image characteristics will be needed. One of the most important characteristics of the deep neu- ral network is that hyperparameters, such as the number of layers and hidden units, also have great inﬂuence on the performance. We tried a 2-layer LSTM network, pretrain- ing with an LSTM-based autoencoder; and bidirectional LSTM networks, to name a few. However, the results from varying hyperparameters and architectures were not notice- ably better compared to those reported in this paper. This study has great signiﬁcance, in that LSTM networks were successfully applied to the challenging problem of precur- sor mi RNA prediction and produced the best result among the currently existing tools. Even more thorough hyper- parameter optimization for additional performance boosts will be considered in our future work. The total time spent on a single run of training was approx- imately 14 hours ( 20 second5 fold500 epoch). Although training takes some time (which is also one of the main issues in deep learning), it will not be a serious drawback in our case, since repetitive training is usually not necessary. Additionally, since the prediction time is comparable to that of the other tools once training has been done, we believe that deep Mi RGene can be an appealing solution for researchers in search of a tool with accurate and robust detection performance. 6. Conclusion Conventional methods for precursor mi RNA identiﬁcation exploit hand crafted feature sets obtained by laborious fea- ture engineering. Many features associated with the struc- tural characteristics have been discovered in related re- search, but the performance of existing approaches mea- sured in terms of accuracy is still limited. Worse, it is be- coming more and more difﬁcult to ﬁnd new effective fea- tures manually, given that more than 100 features have al- ready been identiﬁed. In our study, we have proposed deep Mi RGene, a novel end- to-end learning approach that can identify precursor mi R- NAs using the RNNs, speciﬁcally LSTM networks. The proposed method has a major advantage over existing al- ternatives in that no hand-crafted feature set is needed and it delivers better performance in terms of all the evaluation metrics considered. The structure of a precursor mi RNA is a palindromic, which is difﬁcult to learn even with ordinary LSTM or bidirectional LSTM networks. To address this is- sue, deep Mi RGene uses a novel learning scheme in which the secondary structure of the input sequence is divided into the forward and backward streams and each structure stream is learned in a different sequential direction. By ap- plying the proposed learning method, we expect an effec- tive learning process on the data that may have conﬂicts in temporal direction. In addition, we conﬁrmed the possibil- ity of rediscovering existing structural features by visually inspecting the transition of the LSTM cell states on each position in the sequence. References Agarwal, Sumeet, Vaz, Candida, Bhattacharya, Alok, and Srinivasan, Ashwin. Prediction of novel precursor mirnas using a context-sensitive hidden markov model (cshmm). BMC bioinformatics , 11(Suppl 1):S29, 2010. Bartel, David P. Micrornas: genomics, biogenesis, mecha- nism, and function. cell, 116(2):281–297, 2004. Bastien, Fr ´ed´eric, Lamblin, Pascal, Pascanu, Razvan, Bergstra, James, Goodfellow, Ian J. , Bergeron, Arnaud, Bouchard, Nicolas, and Bengio, Yoshua. Theano: new features and speed improvements. Deep Learning and Unsupervised Feature Learning NIPS 2012 Workshop, 2012. Batuwita, Rukshan and Palade, Vasile. micropred: effec- tive classiﬁcation of pre-mirnas for human mirna gene prediction. Bioinformatics , 25(8):989–995, 2009. Bengio, Yoshua, Simard, Patrice, and Frasconi, Paolo. Learning long-term dependencies with gradient descent is difﬁcult. Neural Networks, IEEE Transactions on , 5 (2):157–166, 1994. Bergstra, James, Breuleux, Olivier, Bastien, Fr ´ed´eric, Lamblin, Pascal, Pascanu, Razvan, Desjardins, Guil- laume, Turian, Joseph, Warde-Farley, David, and Ben- gio, Yoshua. Theano: a CPU and GPU math expression compiler. In Proceedings of the Python for Scientiﬁc Computing Conference (Sci Py) , June 2010. Oral Pre- sentation. Chollet, Franc ¸ois. Keras: Theano-based deep learning li- brary. Code: [URL] com/fchollet. Documenta- tion: [URL] io , 2015. de ON Lopes, Ivani, Schliep, Alexander, and de Carvalho, Andr ´e CP de LF. The discriminant power of rna features for pre-mirna recognition. BMC bioinformatics , 15(1):1, 2014
no obvious changes in the percentage of each resource will occur in the future. Therefore, other kind of resources will also show similar 3. Results trends of sustainable capability of the resource supply. The average content of copper in WEEE is calculated by Morf et al. and is 3. 1. In-use stocks of EEE in Beijing approximately 41,000 mg/kg (Morf et al. , 2007). These data are consistent with the findings of (Oguchi et al. , 2012), who showed a The penetration rate of household EEE in Beijing is shown in range of 18,000-68,000 mg/kg. Fig. 3, whereas that of office-using EEE is shown in the SI. There was The copper demand for electronic production and the supply of a great fluctuation of the five main EEEs from 2008 to 2009 due to secondary copper recycled from WEEE are shown in Fig. 6. The the global financial crisis, which led to a decline in EEE demand. demand shows a downward trend, despite fluctuation, for the China's government introduced a new subsidy program for buying population declines and the penetration rate is saturated. And the appliances in rural areas in 2009. TV, RE, WM, PC, and AC were supply of secondary copper will increase due to the growth of the sequentially listed in the program, leading to price reduction by as formal recycling ratio before 2037. Therefore, the gap between much as 13%. The program was deemed to be a success because the them will be rapidly reduced during this period. As shown in Fig. 7 penetration rate increased significantly and the average growth (a), this indicates that the SSI will increase and maintain more than rate of the five major EEEs reached 9. 4% in 2010. As shown in Fig. 4, 90% of ASD (ASD means the status that the sustainable resource comparing to the penetration rate, the growth rate of in-use stock supply has been achieved) after 2037. Interestingly, we have remains stable before it reaches the maximum value. This phe- assumed that the formal recycling ratio will increase at the rate of nomenon may be attributed to population growth offsetting the 2% annually and will be stable at a maximum value of 85%. The 2% impact of the falling penetration rate. growth rate continues to 2037. Thus, the formal recycling ratio can determine whether the electronics industry can achieve a sus- 3. 2. The sales and formal recycled EEE in Beijing tainable resource supply using secondary-resources recycled from WEEE. The EEE lifespan distribution is shown in the SI. The average As shown in Fig. 7(a), a downward trend is shown in the demand lifespan of a refrigerator is the longest (up to 8. 5 years), followed by for primary resources over time. For instance, it will be maintained TV, WM and AC (approximately 8 years), and PC (5. 2 years due to at less than 1000 tonnes after 2037, which is approximately 15% of the very fast upgrading). The sales and obsolete quantities of PC that in 2015. However, because the goal of ASD cannot be achieved with upper bound are shown in Fig. 5, while those for PC with LB in the long-term, PRAC will continue to increase and cannot reach are shown in the SI. There is a large gap between the sales curve and the maximum after a given year. For the five main EEEs, it will reach the obsolete curve for each type of the EEE before 2015. However, 157 thousand tonnes from 2010 to 2050, where AC, with the the latter parts almost coincide, which provides a possibility for highest PRAC, can reach 59,300 tonnes, followed by RE with 38,700 achieving a sustainable resource supply of the electronics industry tonnes, and the others with approximately 20,oo0 tonnes for each based on recycled materials from WEEE. type. Due to the impact of the informal sector, recycled WEEEs from If calculated in accordance with the trend of PC with LB, the dismantling companies are far less than obsolete EEE. As China's results will be very similar to the above ones. As shown in Sl, the SSI government gradually enhances the capability of law enforcement, will also increase and maintain more than 90%-ASD after 2037 and WEEE recycling by backyard recyclers will be squeezed out of the PRAC will reach 153 thousand tonnes from 2010 to 2050, which is 1. 0 Historical data←- Projected data 0. 8 HHH 0. 6 un 0. 4 **业 TV PC(UB)-H 0. 2 PC(LB)-H -RE -AC-H -WM 0. 0 1985 1990 1995 2000 2005 2010 2015 2020 2025 2030 2035 2040 2045 2050 Fig. 3. Penetration rate of household EEE in Beijing. Y. Gu et al. /Journal of Cleaner Production 127(2016) 331-338 335 3000 2500 2000 1500 三 1000 -LT 500 ←- TV --PC(UB) --PC(LB) --RE -* AC -- WM 0 20002005 201020152020202520302035204020452050 Fig. 4. In-use stock of EEE in Beijing. 50 18 TV-O PC-O RE-O AC-O——WM-O EEE-O →EEE-S 40 15 TV-S PC-S RE-S AC-S WM-S 12 30 一 6 10 3 200020102020203020402050 2010 2015 2020 2025 20302035 2040 2045 2050 (a) Total quantity (b) Quantity of each type of EEE Fig. 5. The sales and the obsolete quantity of EE in Beijing from 2000 to 2050 (In this Figure, O here means obsolete, e. g. , RE-O means the generation amount of obsolete RE. S denotes sales, e. g. , RE-S means the sales quantity of RE. ). 2. 0 0. 8 WEEE-Supply ←EEE-demand 0. 6 TV-demand ——PC-demand——RE-demand ——AC-demand WM-deman 1. 5 1. 0 0. 4 0. 5 0. 2 0. 0 0. 0 2010 2020 2030 2040 2050 2010 2014 2018 2022 2026 2030 2034 2038 2042 2046 2050 (a) Total quantity (b) Quantity of each type of EEE Fig. 6. The copper demand for electronicsproduction and thesupply of the se ondary copper recycled from the WEEE in Beijing from 2010 to 2050. only 2. 5% less than that in the UB case. Therefore, the sustainable recycling peak scenario (HFRP), and the resource reduction sce- capability of resource supply is not sensitive to the selection of the nario (RR), are used to assess the impact on the SSI and PRAC. asymptotic value of the penetration rate. The sustainable capability of the four scenarios is shown in Fig. 7 (b, c, d, and e). Two guidelines, 90%-ASD and ASD, are set as ref- 4. Discussion erences to study the impacts on the SSI of all of the scenarios. Compared with Bs, the LS scenario can promote economic devel- Four key assumptions in the baseline scenario (Bs) discussed opment, as it will increase the sales quantity to 81. 4 million units above are chosen to analyze the uncertainty of the model: (1) the (equivalent to an annual increase of 1. 6 million units in Beijing from lifespan of EEE remains unchanged, (2) the formal recycling ratio 2010 to 2050). In the meantime, it will increase the number of remains at an annual growth rate of 2%, (3) and is limited to a formally dismantled WEEE up to 54. 3 million units, which can maximum of 85%, (4) and the quantity of resource content in EEE effectively alleviate the overcapacity of the formal sector (CHEARI, remains unchanged. As is shown in Table 1, they are reset to 2014). However, the LS scenario will prolong the time to reach determine a better approach to achieve a sustainable resource 90%-ASD and will increase PRAC by 15. 3% from 2010 to 2050, which supply in the electronics industry. Corresponding scenarios, which is not conducive for sustainable resource supply. include the lifespan shortening scenario (LS), the high-speed Compared with BS and LS scenarios, HFRG, HFRP and RR sce- formal recycling growth scenario (HFRG), the high formal narios, however, are beneficial for sustainable development. The 336 Y. Gu et al. /Journal of Cleaner Production 127(2016)331-338 2. 0 120% 1. 6 100% 80% 1. 2 60% 0. 8 40% 0. 4 20% 0. 0 0% 2010 2015 2020 2025 2030 2035 2040 2045 2050 2010 2015 2020 2025 2030 2035 2040 2045 2050 (a) BS scenario (b) LS scenario 2. 0 120% 1. 6 100% 80% ility 1. 2 60% 00001) 0. 8 40% oply 0. 4 20% 0% 0. 0 (SSI) 2010 2015 2020 2025 2030 2035 2040 2045 2050 2010 2015 2020 2025 2030 2035 2040 2045 2050 (c)HFRG scenario (d) HFRP scenario 2. 0 120% 1. 6 100% 80% 1. 2 60% 0. 8 40% 0. 4 20% 0
, Keller, J. , Ledezma, P. , Freguia, S. (2017). A novel bioelectrochemical system for chemical-free permanent treatment of acid mine drainage. Water Research, 126, 411-420. 118. Pumpel, T. , Macaskie, L. 119. Pethkar, A. V. , Kulkarni, S. K. , & Paknikar, K. M. (2001). Comparative studies on metal biosorption by two strains of Cladosporium cladosporioides. Bioresource technology. 80(3), 211-215. Pradhan, J. K. , Kumar, S. , 2012. Metals bioleaching from electronic waste by. 120. Chromobacterium violaceum and Pseudomonads sp. Waste Manag. Res. 30, 1151-1159 doi:10. 1177/0734242X12437565. 121. Qu, Y. , Lian, B. , 2013. Bioleaching of rare earth and radioactive elements from red mud using RM-10. Bioresour. Technol. 136, 16-23. doi:10. 1016/j. biortech. 2013. 03. 070. 122. Pumpel, T. , Macaskie, L. E. , Finlay, J. A. , Diels, L. , Tsezos, M. (2003). Nickel removal from nickel plating waste water using a biologically active moving-bed sand filter. Biometals. 16. 567-581. Rawlings, D. E. , Johnson, D. B. , 2007. The microbiology of biomining: Development. 123. and optimization of mineral-oxidizing microbial consortia. Microbiology 153, 315-324. doi:10. 1099/mic. 0. 2006/001206-0. 124. Reed, D. W. , Fujita, Y. , Daubaras, D. L. , Jiao, Y. , Thompson, V. S. , 2016. Bioleaching. of rare earth elements from waste phosphors and cracking catalysts. Hydrometallurgy 166, 34 40. doi:10. 1016/j. hydromet. 2016. 08. 006. 125. Robalds, A. , Naja, G. M. and Klavins, M. , 2016. Highlighting inconsistencies regarding. metal biosorption. Journal of hazardous materials, 304, pp. 553-556. 126. Robinson, B. , 2009. E-waste: an assessment of global production and environmental impacts. Sci. Total Environ. 408, 183-191. doi:10. 1016/j. scitotenv. 2009. 09. 044. 127. Rocchetti, L. , Veglio, F. , Kopacek, B. , Beolchini, F. , 2013. Environmental impact assessment of hydrometallurgical processes for metal recovery from WEEE residues using a portable prototype plant. Environ. Sci. Technol. 47, 1581-1588. doi:10. 1021/es302192t. 36 ACCEPTEDMANUSCRIPT 128. Rohwerder, T. , Gehrke, T. , Kinzler, K. , Sand, W. , 2003. Bioleaching review part A: progress in bioleaching: fundamentals and mechanisms of bacterial metal sulfide oxidation. Appl. Microbiol. Biotechnol. 63, 239-48. doi:10. 1007/s00253-003-1448-7. 129. Rotaru, A. -E. , Jiang, W. , Finster, K. , Skrydstrup, T. , Meyer, R. L. (2012). Non- enzymatic palladium recovery on microbial and synthetic surfaces. Biotechnology and Bioengineering, 109, 1889-1897. 130. Ruan, J. , Zhu, X. , Qian, Y. , Hu, J. , 2014. A new strain for recovering precious metals from waste printed circuit boards. Waste Manag. 34, 901-907. doi:10. 1016/j. wasman. 2014. 02. 014. 131. Sand, W. , Gehrke, T. , Jozsa, P. G. , Schippers, A. , 2001. (Bio)chemistry of bacterial leaching - direct vs. indirect bioleaching. Hydrometallurgy 59, 159-175. doi:10. 1016/S0304-386X(00)00180-8. 132. Schluep, M. , Hagelueken, C. , Kuehr, R. , Magalini, F. , Maurer, C. , Meskers, C. Muellera, E. , Wang, F. , 2009. Recycling - From e-waste to resources. Berlin. 133. Schwarzer, S. , De Bono, A. , Giuliani, G. , Kluser, S. , Peduzzi, P. , 2005. E-waste, the hidden side of IT equipment's manufacturing and use. 134. Sert. S; Kutahyali. C; Inan. S; Talip. S; Cetinkaya. B & Eral. M. (2007). Biosorption of lanthanum and cerium from aqueous solutions by Platanus orientalis leaf powder. Hydrometallurgy. P 13-18. 135. Shabani, M. A. , Irannajad, M. , Azadmehr, A. R. et al. Int J Miner Metall Mater (2013) 20: 1130. doi:10. 1007/s12613-013-0845-x. 136. Shin, D. , Jeong, J. , Lee, S. , Pandey, B. D. , Lee, J. C. , 2013. Evaluation of bioleaching. factors on gold recovery from ore by cyanide-producing bacteria. Miner. Eng. 48, 20-24. doi:10. 1016/j. mineng. 2013. 03. 019. 137. Shin, D. , Kim, J. , Kim, B. , Jeong, J. , Lee, J. , 2015. Use of phosphate solubilizing bacteria to leach Rare Earth Elements from monazite-bearing ore. Minerals 5, 189-202. doi:10. 3390/min5020189. 138. Silva, R. A. , Park, J. , Lee, E. , Park, J. , Choi, S. Q. , Kim, H. , 2015. Influence of bacterial adhesion on copper extraction from printed circuit boards. Sep. Purif. Technol. 143, 169- 176. doi:10. 1016/j. seppur. 2015. 01. 038. 139. St EP, 2015. St EP E-waste World Map - European Union - STEP [Ww W Document]. St EP E-waste World Map. Suja, E. , Nancharaiah, Y. V. , Venugopalan, V. P. (2014). Biogenic nanopalladium. 140. production by self-immobilized granular biomass: Application for contaminant remediation. Water Research, 65, 395-401. 141. Sun, Z. H. I. , Xiao, Y. , Sietsma, J. , Agterhuis, H. , Visser, G. , Yang, Y. , 2015. Selective copper recovery from complex mixtures of end-of-life electronic products with ammonia- based solution. Hydrometallurgy 152, 91-99. doi:10. 1016/j. hydromet. 2014. 12. 013 142. Sun, Z, Cao, H, Xiao, Y, Sietsma, J, Jin, W, Agterhuis, H, Yang, Y. 2017. Toward sustainability for recovery of critical metals from electronic waste: The Hydrochemistry. Processes. ACS Sustainable Chemistry & Engineering 5 (1), 21-40. DOI: 10. 1021/acssuschemeng. 6b00841. Tay, S. B. , Natarajan, G. , Rahim, M. N. B. A. , Tan, H. T. , Chung, M. C. M. , Ting, Y. P. , 143. Yew, W. S. , 2013. Enhancing gold recovery from electronic waste via lixiviant metabolic. engineering in Chromobacterium violaceum. Sci. Rep. 3, 2236. doi:10. 1038/srep02236 37 ACCEPTEDMANUSCRIPT Ting, Y. , Pham, V. , 2009. Gold bioleaching of electronic waste by cyanogenic bacteria 144. and its enhancement with bio-oxidation. Adv. Mater. Res. 73, 661-665. doi:10. 4028/www. scientific. net/AMR. 71-73. 661. 145. Tsydenova, O. , Bengtsson, M. , 2011. Chemical hazards associated with treatment of. waste electrical and electronic equipment. Waste Manag. 31, 45-58. doi:10. 1016/j. wasman. 2010. 08. 014 146. Tuncuk, A. , Stazi, V. , Akcil, A. , Yazici, E
Fiocchi C, Roche JK, Michener WM. High prevalence of antibod- The influence of zinc status and malnutrition on immunological function in Crohn's disease. Gastroenterology 1991;100:1616- ies to intestinal epithelial antigens in patients with inflammatory 1625. bowel disease and their relatives. Ann Intern Med 1989;110: 8. O'Morain C, Segal A, Levi A. Elemental diet as a primary 786-794. treatment of acute Crohn's disease: a controlled study. BMJ 28. Bayless TM, Tokayer AZ, Polito JM, Quaskey SA, Millits ED, 1984;288:1859-1862 Harris ML. Crohn's disease: concordance for site and clinical 9. Lochs H, Steinhardt HJ, Klaus-Wentz B, Zeitz M, Vogelsang H, type in affected family members— potential hereditary influ- Sommer H, Fleig WE, Bauer P, Schirrmeister J, Malchow H. ences. Gastroenterology 1996;111:573-579. Comparison of enteral nutrition and drug treatment in active 29. Asquith P, Stokes PL, Mackintosh P, Holmes GKT, Cooke WT. Crohn's disease. Gastroenterology 1991;101:881-888. Histocompatibility antigens in patients with inflammatory bowel 10. Teahon K, Bjarnason I, Pearson M, Levi AJ. Ten years' experi- disease. Lancet 1974;1:113-115. ence with an elemental diet in the management of Crohn's 30. Asakura H, Tsuchiya M, Aiso S, Watanabe M, Kokayashi K, Hibi disease. Gut 1990;31:1133-1137. T, Ando K, Takata H, Sekiguchi S. Association of the human July 1998 IBD ETIOLOGY AND PATHOGENESIS199 lymphocyte-DR2 antigen with Japanese ulcerative colitis. Gastro- TM. Preliminary evidence for genetic anticipation in Crohn's enterology 1982;82:413-418. disease. Lancet 1996;347:798-800. 31. Satsangi J, Welsh Kl, Bunce M, Julier C, Farrant JM, Bell JI, 47. Fredericks DN, Relman DA. Sequence-based evidence of micro- Jewell DP. Contribution of genes of the major histocompatibility bial disease causation: when Koch's postulates don't fit. J NIH complex to susceptibility and disease phenotype in inflamma- Res 1996;8:39-44. tory bowel disease. Lancet 1996;347:1212-1217. 48. Blaser MJ, Miller RA, Lacher J, Singleton JW. Patients with active 32. Duerr RH, Neigut DA. Molecularly defined HLA-DR2 alleles in Crohn's disease have elevated serum antibodies to antigens of ulcerative colitis and an antineutrophil cytoplasmic antibody- seven enteric bacterial pathogens. Gastroenterology 1984;87: positive subgroup. Gastroenterology 1995;108:423-427. 888-894. 33. Roussomoustakaki M, Satsangi J, Welsh K, Louis E, Fanning G, 49. Bull DM, Ignaczak TF. Enterobacterial common antigen-induced Targan S, Landers C, Jewell DP. Genetic markers may predict Iymphocyte reactivity in inflammatory bowel disease. Gastroen- disease behavior in patients with ulcerative colitis. Gastroenter- terology 1973;64:43-50. ology 1997;112:1845-1853. 50. Pirzer U, Schonhaar A, Fleischer B, Hermann E, Buschenfelde 34. Toyoda H, Wang S, Yang H-J, Redford A, Magalong D, Tyan D, K-HM. Reactivity of infiltrating T lymphocytes with microbial Mc Elree CK, Pressman SR, Shanahan F, Targan SR, Rotter Jl. antigens in Crohn's disease. Lancet 1991;338:1238-1239. Distinct associations of HLA class Il genes with inflammatory 51. Fabia R, Ar Rajab A, Andersson M-L, Willen R, Jeppsson B, Molin bowel disease. Gastroenterology 1993;104:741-748. G, Bengmark S. Impairment of bacterial flora in human ulcer- 35. Yang H, Rotter JIl, Toyoda H, Landers C, Tyan D, Mc Elree CK, ative colitis and experimental colitis in the rat. Digestion Targan SR. Ulcerative colitis: a genetically heterogenous disor- 1993;54:248-255. der defined by genetic (HLA class Il) and subclinical (antineutro- 52. Chadwick Vs, Anderson RP. Inflammatory products of commen- phil cytoplasmic antibodies) markers. J Clin Invest 1993;92: sal bacteria and gastrointestinal disorders. Dig Dis 1990;8: 1080-1084. 253-268. 36. Nakajima A, Matsuhashi N, Kodama T, Yazaki Y, Tazakoe M, 53. Duchmann R, Kaiser l, Hermann E, Mayet W, Ewe K, Buschen- Kimura A. HLA-linked susceptibility and resistance genes in felde K-HMz. Tolerance exists towards resident intestinal flora Crohn's disease. Gastroenterology 1995;109:1462-1467. but it is broken in active inflammatory bowel disease (IBD). Clin 37. Danze P-M, Colombel J-F, Jacquot S, Loste M-N, Heresbach D, Exp Immunol 1995;102:448-455. Ategbo S, Khamassi S, Perichon B, Semana G, Charron D, 54. Duchmann R, Schmitt E, Knolle P, Buschenfelde K-HMz, Neurath Cezard J-P. Association of HLA class Il genes with susceptibility M. Tolerance towards resident intestinal flora in mice is abro- to Crohn's disease. Gut 1996;39:69-72. gated in experimental colitis and restored by treatment with 38. Forcione DG, Sands B, Isselbacher KJ, Rustgi A, Podolsky DK, interlukin-10 or antibodies to interleukin-12. Eur 」 Immunol Pillai S. An increased risk of Crohn's disease in individuals who 1996;26:934-938. inherit the HLA class Il DRB3*0301 allele. Proc Natl Acad Sci 55. Rutgeerts P, Geboes K, Peeters M, Hiele M, Penninckx F, Aerts USA1996;93:5094-5098. R, Kerremans R, Vantrappen G. Effect of faecal stream diversion 39. Mansfield JC, Holden H, Tarlow J K, Di Giovane FS, Mc Dowell TL, on recurrence of Crohn's disease in the neoterminal ileum. Wilson AG, Holdsworth CD, Duff GW. Novel genetic association Lancet 1991;2:771-774. between ulcerative colitis and the anti-inflammatory cytokine 56. D'Haens G, Geboes K, Peeters M, Baert F, Penninckx F, interleukin-1 receptor antagonist. Gastroenterology 1994;106: Rutgeerts P. Early lesions caused by infusion of intestinal 637-642. contents in excluded ileum in Crohn's disease. Gastroenterol- 40. Yang H, Vora DK, Targan SR, Toyoda H, Beaudet AL, Rotter Jl. ogy 1998;114:262-267. Intercellular adhesion molecule 1 gene associations with immu- 57. Ruseler-van-Embden JGH, Schouten WR, van Lieshout LMC. nologic subsets of inflammatory bowel disease. Gastroenterol- Pouchitis: result of microbial imbalance. Gut 1994;35:658- ogy 1995;109:440-448. 664. 41. Plevy SE, Targan SR, Yang H, Fernandez D, Rotter JI, Toyoda H. 58. Komatsu S, Panes J, Grisham MB, Russell JM, Mori N, Granger Tumor necrosis factor microsatellites define a Crohn's disease- DN. Effects of intestinal stasis on intercellular adhesion mol- associated haplotype on chromosome 6. Gastroenterology1996; ecule 1 expression in the rat: role of enteric bacteria. Gastroen- 110:1053-1060. terology 1997;112:1971-1978. 42. Bouma G,Xia B, Crusius JBA, Bioque G, Koutroubakis l, 59. Chiodini RJ, Kruiningen HJV, Thayer WR, Merkal RS, Coutu JA. Von Blomberg BME, Meuwissen SGM, Pena AS. Distribution of Possible role of mycobacteria in inflammatory bowel disease. I. four polymorphisms in the tumour necrosis factor (TNF) genes in An unclassified mycobacterium species isolated from patients patients with inflammatory bowel disease. Clin Exp Immunol with Crohn's disease. Dig Dis Sci 1984;29:1073-1079. 1996;103:391-396. 60
5-6. 0 ppm were integrated to give the relative number of equivalents of NIPAM, iso BOA, and t BA monomers which were then subtracted from integrations determined from pre-polymerization NMR to give the DP. 1,4-dioxane acetone HC(HC） H3C(H2C)10H2C CN H,O 2. 623. 268. 52. 42. 0 13. 0 125120 11. 511. 010. 510. 09. 59. 08. 58. 07. 57. 06. 56. 055504. 54. 03. 53025201. 51. 00. 5 opom Figure S28. Crude pre-polymerization 'H NMR spectrum of P8-LA (acetone-d6). Integration of the two protons of the CTA at 4. 5 ppm (b) was set to 2. The relative integration of the internal standard trioxane at 5. 1 ppm (a) was calculated relative to this to provide a reference to calculate monomer consumption in the post-polymerization NMR. Integration of alkene protons between 5. 5-6. 0 ppm were integrated to give the relative number of equivalents of NIPAM, lauryl acrylate, and t BA monomers. S20 1,4-dioxane acetone H,0T CH2)CH HC(H2C 0. 00. 30. 72. 4 1251201. 511. 010510. 09. 5908580757065605550454035302520151. 00. 500 (ppm) Figure S29. Crude post-polymerization 'H NMR spectrum of P8-LA (acetone-d6). The internal standard trioxane (a) at 5. 1 ppm was integrated and set to the value determined from the pre-polymerization NMR. Integration of alkene protons between 5. 5-6. 0 ppm were integrated to give the relative number of equivalents of NIPAM, lauryl acrylate, and t BA monomers which were then subtracted from integrations determined from pre-polymerization NMR to give the DP. P4-i BA P5-c HA 0. 8 P6-HA R P7-IBOA 0. 6 P8-LA 0. 4 0. 2 0. 0 5000 10000 15000 20000 25000 MWp Eg (Da) Figure S30. Overlayed DMF SEC chromatograms of P4-i BA, P5-c HA, P6-HA, P7-IBOA, and P8-LA prior to t BA deprotection. S21 100 100 80 80 60 uols. 60 ·LA 40 ●IBOA 40 uo ●t BA ●t BA 20 20 ·NIPAM ·NIPAM 0 200 0 100 200 300 100 300 reaction time (min) reaction time (min) Figure S31. Polymerization kinetics of NIPAM, AA, and LA (left) and NIPAM, AA, and IBOA (right) performed in DMSO/1,4-dioxane with timepoints taken in DMSO-d6. H2O_DMSO m,n 17. 1 62. 2 71. 0 125120 11. 511. 0 10. 5100 9. 59. 0858. 07. 57. 06560555. 0454. 0353025201. 51. 00. 5 (ppm) Figure S32. Post-purification 'H NMR of P4-i BA taken in DMSO-d6. Successful purification and deprotection of t BA comonomers to generate the AA monomers are demonstrated by the broad -OH peak at 12 ppm. S22 HODMSO m,n,f 20. 7 68. 2 4. 8 68. 0 1251201. 511. 010. 5100959085807. 5706560555045403530252015100. 500 (ppm) Figure S33. Post-purification 'H NMR of P5-c HA taken in DMSO-d6. Successful purification and deprotection of t BA comonomers to generate the AA monomers are demonstrated by the broad -OH peak at 12 ppm. H2ODMSO m,n,e b 17. 8 60. 1 72. 0 1251201. 51. 010. 510. 09. 59. 08. 580757. 0656055504540353025201. 51. 00. 5 (ppm) Figure S34. Post-purification 'H NMR of P6-HA taken in DMSO-d6. Successful purification and deprotection of t BA comonomers to generate the AA monomers are demonstrated by the broad -OH peak at 12 ppm. S23 HODMSO m,n,f 20. 2 68. 3 1. 6 67. 0 13. 0 12512011. 51. 010. 510. 09. 59. 08. 58. 07. 57. 065605. 55. 045403. 53. 025201. 51. 00. 500 o(ppm Figure S35. Post-purification 'H NMR of P7-i BOA taken in DMSO-d6. Successful purification and deprotection of t BA comonomers to generate the AA monomers are demonstrated by the broad -OH peak at 12 ppm. H,O DMSO Fo HO =OHN HC(H2C)10 m,n,f d 23. 0 69. 3 71. 0 12. 512. 011. 511. 010. 510. 09. 59. 08. 58. 07. 57. 06. 56. 05. 55. 04. 54. 03. 53. 02. 52. 01. 51. 00. 50. 0 6(ppm) Figure S36. Post-purification 'H NMR of P8-LA taken in DMSO-d6. Successful purification and deprotection of t BA comonomers to generate the AA monomers are demonstrated by the broad -OH peak at 12 ppm. S24 Curve-fitting Residuals P1-BA(5)(metal-free) 0. 15 0. 10 0. 05 0. 00 0. 05 0. 10 s -0. 15 Polymer excluded -0. 20 volumemodel -0. 25 10- 10- Q(A-1) Q(A-1) P6-HA (metal-free) 0. 4 0. 2 0. 0 -0. 2 Polymer excluded -0. 4 volume model 10-3 10-1 10-1 Q(A-1) Q(A-1) P5-c HA(metal-free) 10 Polymer excluded 0. 4 volume model 0. 6 10-1 10-1 Q(A-1) Q(A-1) P8-LA (metal-free) Polymer excluded volume model Q(A-1) Q(A-1) Figure S37. Fitting of the excluded volume polymer model to small-angle scattering (SAXS) profiles of polymer dissolved to 2. 5 mg/m L in plain buffer (40 m M MES, 100 m M KCl, p H 6). Experimental data (left) is represented as blue dots with error bars and the fitted model is represented as the yellow trace. Residuals of the fit (right) is also shown. S25 Curve-fitting Residuals P1-BA(5)(metal-free) Guinier-Porod model Q(A-2) P6-HA (metal-free) Guinier-Porod model 10- Q(A-2) P5-c HA (metal-free) Guinier-Porod model 10- Q(A-2) P8-LA (metal-free) Guinier-Porod 0 model 10-1 10-1 Q(A-1) Q(A-1) Figure S38. Fitting of the Guinier-Porod model to small-angle scattering (SAXS) profiles of polymer dissolved to 2. 5 mg/m L in buffer (40 m M MES, 100 m M KCl, p H 6). Experimental data (left) is represented as blue dots with error bars and the fitted model is represented as the yellow trace. Residuals of the fit (right) is also shown. S26 No Eu3 Eu Model Rg (A) Porod Fitting error Model R。 (A) Porod Fitting error P1-BA(5) PEV 42. 7 ± 7. 7 1. 7 ± 0. 26 0. 004 PEV 46. 2 ± 3. 5 1. 5 ±0. 07 0. 021 PEV 0. 013 P6-HA 40. 6 ±3. 2 1. 8± 0. 14 PEV 43. 6 ± 2. 1 2. 0 ±0. 07 0. 013 P5-CHA PEV 38. 5 ± 3. 0 1. 7 ± 0. 13 0. 024 PEV 33. 0 ± 2. 0 1. 9 ± 0. 43 0. 035 P8-LA GP 29. 2± 3. 3 2. 2±0. 11 0. 020 GP 31. 0±0. 93 3. 1±0. 07 0. 300 Table S1. Results of fitting to the polymer excluded volume (PEV) or Guinier-Porod (GP) model. Extracted parameters for Rg and Porod exponent are shown with errors from the fit represented in parentheses. Volume Side chain Bmin (A) Bmax (A) L (A) SASA (A²) Log P (cm/mol) butyl 2. 02 4. 30 7. 85 331. 84 2. 93 133
High-p H-magnesium coagulation- Hydrometallurgy 82, 83-92. flocculation in wastewater treatment. Advances in Environmental WMC, 2000. WMC Sustainability Report. WMC, Australia. Research 7, 389-403. Xiao, M. , Zhou, J. , Tan, Y. , Zhang, A. , Xia, Y. , Ji, L. , 2006. Treatment of Sengupta, S. , Sengupta, A. K. , 1997. Heavy metal separation from sludge highly-concentrated phenol wastewater with an extractive membrane using chelating exchangers with nontraditional morphology. Reactive reactor using silicone rubber. Desalination 195, 281-293. and Functional Polymers 35, 111-134. Yalkowsky, S. H. , He, Y. , 2006. The Aquasol Database of Aqueous Shahnawaz, S. , Yoon, Y. , Amy, G. , Yoon, J. , 2004. Determining the Solubility, sixth ed. University of Arizona, College of Pharmacy, effectiveness of conventional and alternative coagulants through Tucson, AZ. effective characterization schemes. Chemosphere 57, 1115-1122. Yamada, Y. , Kawase, Y. , 2006. Aerobic composing of waste activated Sharpe, D. W. A. , 1990. Dictionary of Chemistry, second ed. Penguin sludge: kinetic analysis for microbial reaction and oxygen consump- Books, London. tion. Waste Management 26, 49-61. Shigendo, A. , Yang, L. , Takeuchi, H. , 1997. Micellar-enhanced ultrafil- Yang, Q. , Chen, J. , Zhang, F. , 2006. Membrane fouling control in a tration of gold(Ill) with nonionic surfactant. Journal of Membrane submerged membrane bioreactor with porous, fexible suspended Science 133, 189-194. carriers. Desalination 189, 292-302. Sole, K. C. , Feather, A. M. , Cole, P. M. , 2005. Solvent extraction in Yeom, S. H. , Daugulis, A. J. , 1999. A new method for the determination of Southern Africa: an update of some recent hydrometallurgical microbial activity and critical log P in the presence of organic solvents. developments. Hydrometallurgy 78, 52-78. Biotechnology Techniques 13, 549-553. Songling, Y. , Jimin, Y. , Zhonguan, Y. , 1993. 19-23 Alkyliminodimeth- Yeom, S. H. , Daugulis, A. J. , 2001. Benzene degradation in a two-phase ylenephosphonic acid, a new extractant for gold from acidic thiourea bioreactor by Alcaligenes xylosoxidans Y234. Process Biochemistry 36, solutions. Hydrometallurgy 32, 181-188. 765-772
Cyclic di- GMP (cyclic di-GMP) was the first to be reported in 1987 as an allosteric regulator of cellulose biosynthesis [1] and has emerged as a widespread regulator of biofilm and motility, virulence, cell cycle progression, and cell differentiation, reviewed in [2, 3]. Cyclic di-GMP levels are regulated by balancing the rate of synthesis and degra- dation. In the original paper identifying cyclic di-GMP, Benziman's group showed that the molecule is synthesized from two GTP molecules diguanylate cyclases (DGCs) and is linearized into p Gp G by phosphodiesterases (PDE-A) and then further hydrolyzed to two GMPs with enzymes with phosphodiesterase B (PDE-B) activity [1]. Subsequently, the Benziman lab identified the genetic loci responsible for synthesizing and linearizing cyclic di-GMP, suggesting that proteins containing the GGDEF and EAL domains are involved in synthesis and turnover [4]. Work from multiple labs later confirmed the GGDEF possess DGC activity and EAL domains are responsible for PDE-A activity [5-8]. Several years later, the HD-GYP domain enzymes were shown to hydrolyze cyclic di-GMP to GMP via a p Gp G intermediate in vitro [9, 10]. These domains were found to be widespread in bacteria [11], although it was noted that some bacteria that encoded diguanylate cyclases had only EAL domain proteins, leading to the question of how species without HD-GYP proteins could hydrolyze p Gp G to GMP. In addition to cyclic di-GMP, in the past decade two other cyclic dinucleotide signaling molecules have been characterized. Cyclic di-AMP (cyclic di-AMP) was identified serendipitously in the first diadenylate cyclase crystal structure [12] and subsequently characterized to be involved in DNA repair, cell wall maintenance, osmotic stress, central metabolism, potassium homeostasis, and virulence (reviewed in [13-15]). More recently, cyclic-AMP-GMP (c GAMP) was reported as a virulence determinant in Vibrio cholerae [16] and a regulator of extracellular electron transport in Geobacter [17, 18]. Both cyclic di-AMP and c GAMP are first linearized by phosphodiesterases, and the conversion of linear dinucleotides to mononucleotides appears to be mediated by a distinct enzymatic step. This chapter will summarize the current research on the enzymes responsible for degradation of the linear dinucleo- tide turnover by distinct enzymes and propose directions for future investigation. Linear dinucleotides can also arise from other sources (such as RNA degradation, abortive transcription, or release of reaction intermediate from cyclic dinucleotide cyclases) to give rise to both 5'-mono- and 5'-tri-phosphorylated dinucleotides. For the sake of space, this chapter will focus on the 5'-monophosphate dinucleotides generated from cyclic dinucleotide linearization, i. e. p Gp G, p Ap A, and p Ap G. 6. 2 Intracellular Effects of p Gp G In any signaling system, signal termination is required to reset the system to baseline The observation that EAL domain phosphodiesterases only hydrolyze cyclic di-GMP to p Gp G has raised the question as to whether p Gp G has a signaling role of its own 6Enzymatic Degradation of Linear Dinucleotide Intermediates of Cyclic. : 95 and how it is ultimately degraded to GMP. In cyclic di-GMP signaling, linear p Gp G can engage in feedback inhibition of cyclic di-GMP turnover. This was first observed in in vitro experiments for the EAL domain phosphodiesterase Yfg F from Escherichia coli, where preincubation of purified Yfg F with p Gp G prevented cyclic di-GMP hydrolysis [19]. The p Gp G-mediated inhibition of other EAL domain phosphodies- terases from P. aeruginosa was observed [20, 21] and appears to act via competitive inhibition by occupying the active site. Furthermore, oligoribonucleotides have been shown to prime transcription initiation in vivo and cause global alterations in gene expression by affecting transcription start sites, transcription initiation efficiency, and/ or transcript stability [22, 23]. 5' RNA-seq showed enrichment of TA and GG sequences in stationary phase oligoribonucleotide primed transcripts in both E. coli and Vibrio cholerae, suggesting that oligos with the p Up A and p Gp G sequences are preferentially generated in this growth phase [24]. Since many GGDEF and EAL domain genes are induced during stationary phase in E. coli (reviewed in [25]), it is possible that the p Gp G oligos are derived from the cyclic di-GMP linearization product. Thus, the activity of the p Gp G turnover enzyme is likely important in regulating cyclic di-GMP homeostasis and gene transcription 6. 3 Oligoribonuclease (Orn) Is the Primary Phosphodiesterase That Degrades p Gp G to GMP Two groups identified Orn as the primary degradative enzyme responsible for cleavage of p Gp G to GMP in P. aeruginosa. Cohen et al. and Orr et al. identified Orn as the major enzyme responsible for p Gp G hydrolysis in P. aeruginosa [20, 21]. Both groups reported that loss of orn resulted in increased cyclic di-GMP and p Gp G, indicating that the activity of the p Gp G turnover enzyme is required to fully terminate cyclic di-GMP signaling. Interestingly, HD-GYP domain phospho- diesterases have been shown to cleave cyclic di-GMP to GMP in vitro [9, 10]. How- ever, several lines of evidence suggest that HD-GYP are not the main contributor to p Gp G turnover in vivo. First, HD-GYP domain proteins are not encoded by all species that use cyclic di-GMP signaling [11]. Second, genetic inactivation of individual HD-GYP domain phosphodiesterases had no effect on the ability of cell lysates to turn over p Gp G [21]. Third, expression of HD-GYP domain genes from Vibrio cholerae in a P. aeruginosa △orn mutant failed to restore p Gp G hydrolysis [26]. These observations suggest that while HD-GYPs could have p Gp G cleaving capabilities, they are either not the main enzymes responsible for p Gp G turnover or are only active under specific conditions. Together, these studies suggest that Orn is the primary phosphodiesterase that cleaves p Gp G in P. aeruginosa. 96 M. W. Orr and V. T. Lee 6. 4 Discovery of Orn and Its Functions in RNA Degradation Prior to the recently described role of Orn in degradation of p Gp G, Orn was discovered over 50 years ago as an exoribonuclease enzyme that degrades RNA [27, 28]. During RNA turnover, RNAs (m RNA, r RNA, t RNA, and other RNA species) are first cleaved internally by endonucleases (such as RNase E and RNase G)into fragments [29]. These fragments are cleaved from the 3' or 5' ends by exoribonucleases down into shorter oligoribonucleotide fragments. These 2--7 nucleotide long oligoribonucleotides are then degraded to mononucleotides by specialized RNases, such as Orn, with specificity toward short substrates. Orn enzymatic activity was first reported in 1965 in a fraction of E. coli capable of rapidly degrading poly-A oligonu- cleotides [30]. Orn was purified from E. coli and biochemical characterization indi- cated degradation of oligoribonucleotides of various lengths [27, 31]. The orn gene was identified [32] and was shown to be essential in E. coli as deletions could not be generated [33]. Furthermore, conditional depletion of orn via a temperature-sensitive plasmid resulted in cessation of growth [33]. A temperature-dependent strain accu- mulated 2-5 nucleotide long oligos [33], indicating that Orn is the major enzyme responsible for degrading short RNAs oligos of this size in E. coli. These studies and the more recent studies suggest that Orn is the “finishing enzyme” in RNA degradation and cyclic di-GMP signaling in organisms that encode orn. 6. 5 Nano RNAses as Linear Dinucleotide Phosphodiesterases However, orn orthologs are not found in all bacteria, suggesting that evolutionarily unrelated enzymes fill this role in other species. Proteins with Orn-like functions from other bacteria lacking orn have recently been identified using two different strategies. The first strategy took advantage of the observation that p Ap is bound by Orn [34]. A search for p Ap-binding proteins identified Nrn A from B. subtilis as a bifunctional oligoribonuclease and p Ap phosphatase [35]. The second strategy took advantage of the lethality of orn mutations in E. coli. A screen of a plasmid library containing genomic fragments of B. subtilis for genes that can restore growth to E. coli depleted of orn identified Nrn B [36]. In a similar screen of a library of Bartonella birtlesi, Nrn C was identified as a gene that can restore growth to E. coli depleted of orn [37]. Like Orn, Nrn A, Nrn B, and Nrn C were shown to be able to cleave short oligoribonucleotides to monomers and displayed far higher rates (>1000×) of in vitro activity against 5-mers compared to 24-mers, suggesting that they are specific for shorter substrates [35-37]. Together, these studies strongly suggest that the ability to degrade very short RNAs or “nano RNAs" is specific to a subset of RNases
Availableonlineatwww. sciencedirect. com INTERNATIONAL JOURNRL OF Science Direct min ERAL PROCESSING ELSEVIER Int. J. Miner. Process. 81 (2006) 35 -43 www. elsevier. com/locate/ijminpro Biosorption of mercury(Il), cadmium(I) and lead(Il) ions from aqueous system by microalgae Chlamydomonas reinhardtii immobilized in alginate beads Gulay Bayramoglu a, Ilhami Tuzun b, Gokce Celik a,b, a Biochemical Processing and Biomaterial Research Laboratory, Faculty of Science, Kirikkale University, 71450 Yahsihan-Kirikkale, Turkey Department of Biology,Faculty of Science,Kirikkale University,71450 Yahsihan-Kirikkale,Turkey Received 2 December 2005; received in revised form 13 June 2006; accepted 16 June 2006 Available online 26 July 2006 Abstract The potential use of the immobilized microalgae (in Ca-alginate) of Chlamydomonas reinhardti to remove Hg(Ml), Cd(Ml) and Pb(Il) ions from aqueous solutions was evaluated using bare Ca-alginate bead as a control system. Ca-alginate beads containing immobilized microalgae were incubated for the uniform growth at 22 °C for 5 days. Effects of p H, temperature, initial concentration of metal ions and biosorbent dosages on the adsorption of Hg(Il), Cd(ml) and Pb(Il) ions were studied. Adsorption of Hg(Il), Cd(Il) and Pb(Il) ions on the immobilized microalgae showed highest values at around p H 5. 0 to 6. 0. The adsorption equilibrium was represented with Langmuir and Freundlich adsorption isotherms. The adsorption of these ions on the immobilized microalgae followed second-order kinetics and equilibrium was established in about 60 min. The temperature change in the range of 5-40 °C did not affect the adsorption capacities of the immobilized microalgae. The immobilized-algal systems can be regenerated using 2 M Na CI for Hg(I), Cd(Il) and Pb(II) ions. ① 2006 Elsevier B. V. All rights reserved. Keywords: Heavy metal; Alginate; Adsorption; Biosorption; Adsorption kinetic; Microalgae 1. Introduction as fungi (Bayramoglu et al. , 2003; Arica et al. , 2004; Al- Qunaibit et al. , 2005; Baik et al. , 2002), bacteria (Trevors The removal ofheavy metal ions by biosorption using et al. , 1986; Saygideger et al. , 2005; Tunali et al. , 2006b) biological materials have been widely studied in the last and yeast (Lamelas et al. , 2005), heavy metal biosorption decade due to its potential, particularly in wastewater capacity of algae proved to be the highest because of the treatment. Compared to some microbial biomasses such algal cell wall, which is composed of a fiber-like structure and an amorphous embedding matrix of var- ious polysaccharides (Ozdemir et al. , 2005; Gekeler * Corresponding author. Biochemical Processing and Biomaterial et al. , 1998). There are several functional chemical Research Laboratory, Faculty of Science, Kirikkale University, 71450 groups on algal cell surface that can attract and sequester Yahsihan-Kirikkale, Turkey. Tel. : +90 318 357 2477; fax: +90 318 357 2329. the heavy metal ions such amino, amido, sulfate and E-mail address: [EMAIL] (M. Y. Arica). carboxyl (Schiewer and Volesky, 2000). Biosorption 0301-7516/$ - see front matter @ 2006 Elsevier B. V. All rights reserved. doi:10. 1016/j. minpro. 2006. 06. 002 36 G. Bayramoglu et al. / Int. J. Miner. Process. 81 (2006) 35-43 mechanisms include ionic interactions and formation of copper, lead, mercury, chromium, etc. , are hazardous to complexes between metal ions and the functional groups the environment. Their presence in the aquatic ecosys- of the cell wall components. The binding characteristics tem poses human health risks and causes harmful effects of metal ions on the biosorbents can partly be explained to living organism in water and also to the consumers of by Lewis' hard and soft acid and base theory and by them (Vilar et al. , 2005). Various methods ofheavy metal Irving-Williams’ series (Schiewer and Volesky, 2000; removal from wastewaters have been proposed such as Crist et al. , 1981). For example, Pb(I1), Cd(I1) and Hg(II) precipitation, membrane filtration, chemical oxidation or ions have been effectively removed using a variety of reduction, ion exchange and adsorption. These techni- algal groups including green (Chlorella vulgaris, Sce- ques are often ineffective or expensive, especially when nedesmus sp. , Chlorococcum sp. and Fischerella sp. ) concentrations are in the order of 1-100 mg L-1. New and blue green algae (Lyngbya spiralis, Tolypothrix technologies are required that can reduce heavy metal tenuis, Stigonema sp. and Phormidium molle) (Inthorn concentrations to environmentally acceptable levels at et al. , 2002). Pb(Il) and Cd(I1) have also been effectively reasonable cost. Biosorption has the potential to greatly segregated from aqueous solutions by the dried biomass contribute to the achievement of this goal. This method is of brown marine algae (Wild and Benemann, 1993). based on metal sequestering properties of certain natural The immobilization of biomass might also provide materials of biological origin. These materials investi- several advantages such as facility to reuse and gated for heavy metals removal include fungi, bacteria separation of solid biomass from the bulk liquid. The and algae (Baik et al. , 2002; Al-Qunaibit et al. , 2005). process will become cost effective by reusing the bio- They are abundant in nature, or/and in by products or mass after regeneration (Bayramoglu et al. , 2003; Arica waste materials from industrial process. et al. , 2005; Prakasham et al. , 1999). Immobilization of In this study, a wild type of C. reinhardti, isolated algal biomass is usually obtained by the entrapment of from a polluted site of Kizilirmak River was cultured to the cells into a matrix of the natural polymers such as achieve the most probable removal efficiency because alginate, chitosan, chitin and cellulose derivatives the species grown in polluted areas were known to be (Bajpai et al. ,2004; Bai and Abraham, 2003). more resistant, and thus having more capability of Polysaccharide gel immobilized microorganisms can accumulating heavy metals. The immobilized C. rein- be used to remove heavy metal ions from aqueous hardti was utilized for the removal of Hg(II), Cd(Il) and solutions, providing an alternative to physico-chemical Pb(Il) from aqueous solution. The effects of contact time, technologies for wastewater treatment (Bayramoglu solid/liquid ratio, and initial concentration of metal ions, et al. , 2003; Veglio et al. , 2002). Alginic acid is a and p H on the adsorption of Hg(Il), Cd(Il) and Pb(II) heteropolysaccharide made of α-L-guluronic acid and β- ions have been investigated. Adsorption of Hg(Il), Cd(II) D-manuromic acid and is found in many algal species and Pb(Il) ions from aqueous solutions on the immobi- especially inside the brown algae. This carboxylic poly- lized C. reinhardti under different kinetic and equilib- electrolyte is soluble in water and precipitates in the rium conditions are scrutinized in some details. Finally, form of a coacervate in the presence of multivalent metal elution-reuse of the free and immobilized C. reinhardtii ions like Ca(II), Co(II), Fe(I), Fe(III) and Al(III) was evaluated. (Bayramoglu et al. , 2003). The immobilization method is easy and can be performed under very mild conditions 2. Materials and methods without damaging the living fungal cells. Although numerous studies are present, using particularly the 2. 1. Microorganism and media entrapped green algae species, Chlorella sp. (Crist et al. , 1981; Jalali et al. , 2002) Chlamydomonas reinhardti Individuals of C. reinhardtii were isolated from the has rarely been utilized for testing the heavy metal fresh water samples obtained from Kizilirmak River in removal efficiency from aqueous solutions (Cai et al. , Turkey. The sampling site selected on the Kizilirmak 1995; Roesijadi, 1992). The unicellular alga, C. River was located 1 km away downstream to the reinhardtii, has recently gained interest in bioremedia- discharge point of an oil refinery. Cell culture was tion studies (Macfie and Welbourn, 2000; Wetzel and grown in minimal base medium adjusted to p H 7. 0, Likens, 1991; Adhiya et al. , 2002)
Capacity additions in 2020 were around 10 GW, and increase to an average of 11 GW in the STEPS and 16 GW in the SDS between 2031 and 2040. Along with hydropower, nuclear is one of the low -carbon technologies with the lowest mineral intensity. Key mineral needs include chromium (2 190 kg/MW in 2019), copper (1 470 kg/MW), nickel (1 300 kg/MW), hafnium (0. 5 kg/MW) and yttrium (0. 5 kg/MW) (EC JRC, 2011). Uranium is not within the scope of our analysis , as this report focuses on mineral requirements for production of equipment, and not for operations. Around 16% of the worldwide supply of hafnium is currently used for nuclear reactor applications (EC JRC, 2011). However, the mineral intensity of chromium and nickel are highly sensitive to the use of high-allo y steel in nuclear power plants. Quantities of high-alloyed, low -alloyed and unalloyed steel used in a nuclear power plant are seldom reported. Considering the maturity of the technology, there are unlikely to be drastic reductions in mineral intensity over the coming decades. As a result, mineral intensity is assumed to be similar in the STEPS, and decline slightly in the SDS. In the SDS, average annual mineral demand from nuclear power between 2031 and 2040 grows by around 60% compared to 2020 levels, reaching 82 kt. It is dominated by chromium (42%), copper (28%) and nickel (25%). Yttrium demand in 2040 is around 7. 7 tonnes, or around 0. 001 5% of current global reserves. We conducted our assessment based on mineral requi rements for light-water reactor technology, which dominates the world’s nuclear fleet (accounting for over 80% of all reactors in operation). Both pressurised -water reactors – the dominant choice for future expansion – and boiling -water reactors have simil ar mineral intensity. However, mineral intensities can be different for small modular reactors or more advanced nuclear technologies, but data for these technologies remains scarce. The Role of Critical Minerals in Clean Energy Transitions PAGE \| 75 Mineral requirements for clean energy transitions Electricity networks The Role of Critical Minerals in Clean Energy Transitions PAGE \| 76 Mineral requirements for clean energy transitions Rising electricity demand, alongside much higher shares of wind and solar PV, requires a significant expansion of electricity networks Annual average grid expansion and replacement needs by scenario IEA. All rights reserved. Source: IEA ( 2020c). 1 0002 0003 0004 0005 0006 000 Driver Type Driver Type Driver Type Driver Type Driver Type 2018-2020 2021-2030 2031-2040 2021-2030 2031-2040 STEPS SDSThousand km Replacement Expansion Transmission Distribution Type of grid Driver of addition The Role of Critical Minerals in Clean Energy Transitions PAGE \| 77 Mineral requirements for clean energy transitions Electricity networks are the backbone of secure and reliable power systems, and have a vital role in integrating clean energy technologies With over 70 million km of transmission and distribution lines worldwide, electricity networks are the backbone of today’s power systems. Distribution systems currently account for over 90% of total line length, and play an increasing role in supporting the integration of residential solar PV and onshore wind capacity, in addition to their traditional role of delivering electricity to regional end users. Likewis e, transmission systems, which are instrumental in connecting large hydro, thermal and nuclear power fleets with load centres, have new tasks to fulfil. For example, they now integrate large amounts of solar PV and wind capacity (in particular offshore wind), strengthen interconnection between countries and increase the resiliency of power systems. These new tasks are supported by the rise of high- voltage direct current (HVDC) technologies. HVDC systems have been used since the 1950s, but over two-third of total installed HVDC transmission capacity has been added in the past 10 years. Today, HVDC systems represent around 7% of newly installed transmission systems and their share is expected to rise further given the considerable technological progress made over the past decade. Many of the features that characterise a clean energy system – the growing role of electricity in final consumption, rising contributions from renewables in electricity supply and the greater need for flexibility – all necessitate significant expansion of electricity grids. The projected requirement for new transmission and distribution lines worldwide in the STEPS is 80% greater over the next decade than the expansion seen in the last ten years. The importance of electricity grids is even greater in the case of faster energy transitions. In the SDS, the annual pace of grid expansion needs to more than double in the period to 2040. Around 50% of the increase in transmission lines and 35% of the increase in distribution network lines are attributable to the increase in renewables. In addition to additional lines, there is scope to refurbish grids to strengthen the resiliency of electricity systems to climate change and extreme weather events. Refurbishment of electricity grids is also strongly linked to digitalisation, given the rising need for smart and flexible grids. Investment in digitalisation and grid flexibility helps increase reliability and can reduce the cost of generating, transmitting and distributing electricity. In the SDS , some 55% of the expansion to 2030 in advanced economies such as the European Union and the United States are attributable to refurbishment and digitalisation. The Role of Critical Minerals in Clean Energy Transitions PAGE \| 78 Mineral requirements for clean energy transitions Growing need for grid e xpansion underpins a doubling of annual demand for copper and aluminium by 2040 in the SDS Demand for copper and aluminium for electricity grids by scenario IEA. All rights reserved. Note: Includes demand for grid expansion and replacement. 5 10 15 20 25 30 2020 2030 2040Mt Distribution Transmission Transformer Distribution Transmission STEPS Aluminium Copper 5 10 15 20 25 30 2020 2030 2040SDS The Role of Critical Minerals in Clean Energy Transitions PAGE \| 79 Mineral requirements for clean energy transitions The choice of material in electricity networks is mainly driven by the type of power line, but is also influenced by cost and technical considerations The huge expansion of electricity grids requires a lar ge amount of minerals and metals. Copper and aluminium are the two main materials in wires and cables, with some also being used in transformers. It is estimated that some 150 Mt of copper and 210 Mt of aluminium are “locked in” the electricity grids operating today. Copper has long been the preferred choice for electricity grids due to its inherent performance advantages. Its electrical conductivity is the second best among various metals after silver and 60% higher than aluminium. Its thermal conductivity, an often-overlooked attribute when designing and operating a grid, is also some 60% higher than aluminium. However, it also has drawbacks. Copper is over three times heavier by weight than aluminium and is more costly – average prices for cop per over the past 10 years were USD 7 100 per tonne (in 2019 dollars) whereas those for aluminium averaged at around USD 2 000 per tonne. This underpins different material choices according to the type of power line. Copper is widely used for underground a nd subsea cables where weight is not a major concern and superior technical properties (e. g. corrosion resistance, tensile strength) are required. By contrast, aluminium is commonly used for overhead lines given its weight advantage. In some instances, aluminium is also used for underground and subsea cables. We estimate that some 5 Mt of copper and 9 Mt of aluminium were used in 2020 to build electricity grids, of which over 55% is attributable to distribution grids. We conducted bottom -up assessments of projected line additions and replacements by type (overhead, underground and subsea), voltage level and respective material choice. These show annual copper demand for electricity grids growing from 5 Mt in 2020 to 7. 5 Mt by 2040 in the STEPS, and more than double that to almost 10 Mt in the SDS. Aluminium demand increases at a similar annual pace, from 9 Mt in 2020 to 13 Mt in the STEPS and 16 Mt in the SDS by 2040. Overhead lines account for a larger share of future expansion by line length, but underground and subsea cables require higher mineral content per unit length. The scope for significant demand growth, coupled with a higher share of raw materials in total cost, raises questions over how companies can reduce material intensity in their grids in order to lower material cost. The Role of Critical Minerals in Clean Energy Transitions PAGE \| 80 Mineral requirements for clean energy transitions Costs for copper and aluminium currently represent around 20% of total grid investment; higher prices could have a major impact on the adequacy of grid invest ment Share of copper and aluminium costs in new grid investment under different price assumptions IEA. All rights reserved. Notes: The shares have been calculated according to total electricity grid investment in 2019, wit h raw material prices adjusted. Darker bars indicate average costs between 2010 and 2019; costs are in USD per tonne. 0%5%10%15%20%25% USD 5 300 10-yr low USD 7 100 10-yr avg. USD 10 000 10-yr high USD 12 000Copper 0%5%10%15%20%25% USD 1 700 10-yr low USD 2 000 10-yr avg. USD 2 700 10-yr high USD 3 500Aluminium The Role of Critical Minerals in Clean Energy Transitions PAGE \| 81 Mineral requirements for clean energy transitions Additional switching to aluminium for underground cables and the wider uptake of DC systems can alter the material requirements considerab ly Copper and aluminium demand for electricity networks in the SDS under alternative cases IEA. All rights reserved
In this review,most studies optimize pulp density with 0. 2 –9. 7% (w/v) range for acidophilic microorganisms. Another fact to consider is that choosing the factors is varied based on the type of waste and microorganism. In some studies investigating the ore and soilmicroorganisms using an acidophilic microorganism, p H andpulp density were evaluated as the main factors. On the otherhand, p H, nutrient/substrate concentration (Fe 2+and S0), and pulp density were considered essential factors for maximizingheavy metals removal from E-waste and sludge, and plant'sresidues. Since the structure of these wastes are more complex than ores and has a considerable percentage of heavy metals (high toxicity), high concentrations of metabolites in the biol-eaching medium is essential. For this reason, the production of metabolites is highly dependent on the nutrient/substrate concentration and p H, sooptimization of these factors is vital in the high recovery of thetarget metal. In conclusion, the successes achieved and thesestudies demonstrate the bene ts and the validity of using RSM as a method of DOE for the bioleaching of precious metals. The future research suggestions for the application of RSM in thebioleaching process are as follows: (1) Integration of advanced optimization strategies: in addition to RSM, future research should explore the integrationof other advanced optimization strategies, such as Dynamic Programming or Genetic Algorithms. These strategies can beapplied to bioleaching experiments involving a large number of 23586 \|RSC Adv. ,2 0 2 3 , 13, 23570 –23589 © 2023 The Author(s). Published by the Royal Society of Chemistry RSC Advances Review factors and can provide alternative approaches for experimental design, optimization, and decision-making. (2) Multi-objective optimization: while RSM is e ﬀective in optimizing a single response variable, future studies shouldconsider multi-objective optimization. This approach enablesthe simultaneous optimization of multiple responses, such asmetal recovery, leaching rate, and energy consumption. Byapplying multi-objective optimization techniques, researcherscan identify trade-o ﬀs and achieve a more comprehensive and sustainable bioleaching process. (3) Advanced screening designs: alongside RSM, future research should employ advanced screening designs, such as Plackett –Burman or Taguchi orthogonal arrays, to e ﬀectively screen and select key factors and their appropriate levels. Thesedesigns allow for e ﬃcient identi cation of in uential factors and reduction of experimental workload, thereby enhancing thesuccess and e ﬃciency of subsequent optimization studies. (4) Comprehensive cost analysis: in addition to the technical aspects of bioleaching optimization, future studies shouldincorporate comprehensive cost analysis. This includes evalu-ating the economic feasibility, operational costs, and scalabilityof optimized bioleaching processes. Considering the costimplications will provide a more holistic understanding andsupport decision-making towards sustainable and commer-cially viable bioleaching operations. (5) Scenario-based optimization: future research could explore multiple optimization scenarios to thoroughly explorediﬀerent aspects and variables related to bioleaching processes. By considering diverse scenarios, such as variations in feed-stock composition, leaching conditions, and recovery targets,researchers can gain a deeper understanding of processdynamics and broaden the applicability of optimizationstrategies. Abbreviations ANOVA Analysis of variance BBD Box –Behnken design BEER Bioleaching enhanced electrokinetic remediation CCD Central composite design CPCB Computer printed circuit boards DOE Design of experiment DOF Degrees of freedom E-waste Electronic waste IOB Iron-oxidizing bacteria IT Information technology LCD Liquid crystal display LED Light-emitting diode LIB lithium-ion battery LSM Least-squares method MPPCB Mobile phone printed circuit board PCB Printed circuit boards PGM Platinum group metals PWB Printed wire boards RSM Response surface methodology SCC Lithium coin cells SOB Sulfur-oxidizing bacteria TPCBs Telecommunication printed circuit boards WLED Waste light-emitting diodes XRF X-ray uorescence spectrometry Author contributions Tannaz Naseri: investigation, writing main parts of the original dra. Vahid Beygi: investigation, writing some parts of the original dra . Seyyed Mohammad Mousavi: project adminis- tration, funding acquisition, supervision, writing-review and editing. Sebastien Farnaud: review and language editing of the nal version. Conﬂicts of interest There are no con icts to declare. Acknowledgements Tarbiat Modares University nancially supported this study under grant number IG-39701. References 1 M. T. Islam, N. Huda, A. Baumber, R. Shumon, A. Zaman, F. Ali, R. Hossain and V. Sahajwalla, J. Cleaner Prod. , 2021, 316, 128297. 2 M. L. Sall, A. K. D. Diaw, D. Gningue-Sall, S. Efremova Aaron and J. -J. Aaron, Environ. Sci. Pollut. Res. , 2020, 27, 29927 – 29942. 3 A. Pathak, H. Al-Sheeha, R. Navvamani, R. Kothari, M. Mara and M. S. Rana, Rev. Environ. Sci. Bio/Technol. , 2022, 21, 1035 –1059. 4 T. Naseri, F. Pourhossein, S. M. Mousavi, A. H. Kaksonen and K. Kuchta, Rev. Environ. Sci. Biotechnol. , 2022, 21, 447 –468. 5 T. Naseri, V. Beigi, A. Namdar, A. Keikavousi Behbahan and S. M. Mousavi, in Nano Technology for Battery Recycling, Remanufacturing, and Reusing , Elsevier, 2022, pp. 217 –246. 6 F. Hosseinzadeh, S. O. Rastegar and M. Ashengroph, Process Biochem. , 2021, 105,1–7. 7 F. Pourhossein and S. M. Mousavi, Waste Manage. , 2018, 79, 98–108. 8 M. E. Hoque and O. J. Philip, Mater. Sci. Eng. , C , 2011, 31, 57–66. 9 B. K. Biswal, U. U. Jadhav, M. Madhaiyan, L. Ji, E. -H. Yang and B. Cao, ACS Sustainable Chem. Eng. , 2018, 6, 12343 – 12352. 10 S. Ilyas and J. Lee, Chem Bio Eng Rev. , 2014, 1, 148 –169. 11 T. Gu, S. O. Rastegar, S. M. Mousavi, M. Li and M. Zhou, Bioresour. Technol. , 2018, 261, 428 –440. 12 F. Anjum, M. Shahid and A. Akcil, Hydrometallurgy , 2012, 117–118,1–12. 13 I. Asghari and S. M. Mousavi, Rev. Environ. Sci. Bio/Technol. , 2014, 13, 139 –161. 14 S. Mohanty, S. Ghosh, B. Bal and A. P. Das, Rev. Environ. Sci. Bio/Technol. , 2018, 17, 791 –811. © 2023 The Author(s). Published by the Royal Society of Chemistry RSC Adv. ,2 0 2 3 , 13,2 3 5 7 0 –23589 \| 23587Review RSC Advances 15 F. Pourhossein and S. M. Mousavi, Resour. , Conserv. Recycl. , 2022, 187, 106599. 16 F. Pourhossein, S. M. Mousavi and F. Beolchini, Resour. , Conserv. Recycl. , 2022, 182, 106306. 17 J. Yao, M. Wang, L. Wang, M. Gou, J. Zeng and Y. -Q. Tang, Environ. Sci. Pollut. Res. , 2022, 29, 48509 –48521. 18 M. Pirsaheb, S. Zadsar, S. O. Rastegar, T. Gu and H. Hossini, Environ. Technol. Innovation , 2021, 22, 101480. 19 A. Pathak, H. Srichandan and D. J. Kim, J. Environ. Manage. , 2019, 242, 372 –383. 20 T. Naseri, N. Bahaloo-Horeh and S. M. Mousavi, J. Environ. Manage. , 2919, 235, 357 –367. 21 M. Arshadi and S. M. Mousavi, Sep. Purif. Technol. , 2015, 147, 210 –219. 22 Y. Zhan, X. Shen, M. Chen, K. Yang and H. Xie, Lett. Appl. Microbiol. , 2022, 75, 1076 –1083. 23 M
Biosorbents for recovery of 05. 062. precious metals. Bioresour. Technol. 160, 203-212. [URL] Zhuang, W. -Q. , Fitts, J. P. , Ajo-Franklin, C. M. , Maes, S. , Alvarez-Cohen, L. , Hennebel, T. ,. 2015. Recovery of critical metals using biometallurgy. Curr. Opin. Biotechnol. 33, biortech. 2014. 01. 121. 327-335. [URL]
htps://doi. org/10. 1021/jm030 223a (2003). 63. Theodorou, M. C. , Theodorou, E. C. & Kyriakidis, D. A. Involvement of ato SC two-component system in Escherichia coli flagellar regulon. Amino Acids 43, 833-844. [URL] (2012). 64. Mackintosh, M. E. Nitrogen fxation by Thiobacillus ferrooxidans. Microbiology 105, 215-218. [URL] 105-2-215 (1978). 65. Harvey, A. E. Jr. , Smart, J. A. & Amis, E. Simultaneous spectrophotometric determination of iron (II) and total iron with 1, 10-phenanthroline. Anal. Chem. 27, 26-29. https:/doi. org/10. 1021/ac60097a009 (1955). 66. Schippers, A. &Sand, W. Bacterialleaching of metal sulides proceeds bytwo indirect mechanisms via thiosulfate or via polysuldes and sulfur. Appl. Environ. Microbiol. 65, 319-321. [URL] (1999). 67. Christel, S. , Fridlund, J, Watkin, E. L. & Dopson, M. Acidithiobacillus ferivorans SS3 presents little RNA transcript response relatedtocold strss during groth at 8suggesting it isaurysychrophil Extremphiles 20903913htp://dorg10007 s00792-016-0882-2 (2016). 68. Andrews, S. Fast QC: a quality control tool for high throughput sequence data. Version 0. 11. 2. Website: [URL] babraham. ac. uk/projects/fastqc (2010). 69. Ewels, P, Magnusson, M. , Lundin, S. & Kaller, M. Multi QC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32, 3047-3048. [URL] (2016). 70. Martin Mutadpt remveadaptr sequence frmhighthoughut qunin reads Mnt J1,12hts:/ 10. 14806/ej. 17. 1. 200 (2011). 71. Krueger, F. et al. A wrapper tool around Cutadapt and Fast QC to consistently apply quality and adapter trimming to Fast Q files. Cambridge, UK: Babraham Institute (2015). 72. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357. [URL] 1923 (2012). 73. Liao, Y. , Smyth, G. K. & Shi, W. The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res. 47, e47-e47. [URL] (2019). 74. Love, M. 1. , Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 1-21. htps:/doi. org/10. 1186/s13059-014-0550-8 (2014). 75. Galperin, M. Y. , Makarova, K. S. , Wolf, Y. I. & Koonin, E. V. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Aacids Res 43, D261-D269. [URL] (2015). Acknowledgements Carlotta Fabbri and Leo Eberl (Department of Plant and Microbial Biology, University of Zurich, Zurich, Switzer- land) kindly provided the biosensor strain Burkholderia cenocepacia H111-rpf FBe (pan-L15). Michael Schlomann (Institute of Biosciences, Environmental Microbiology Group, Technische Universitat Bergakademie Freiberg) kindly provided access to the GC-MS instrument. We acknowledge support from the National Genomics Infra- structure in Stockholm funded by Science for Life Laboratory, the Knut and Alice Wallenberg Foundation and the Swedish Research Council, and SNIC/Uppsala Multidisciplinary Center for Advanced Computational Sci- ence for assistance with massively parallel sequencing and access to the UPPMAX computational infrastructure. Author contributions S. B. , M. V. , and M. D. conceived the study. S. B. , B. S. , and C. J. carried out the microbiological experiments. S. G. and S. B. conducted GC-MS experiments. S. G. , C. R. U. , and M. L. V. analysed GC-MS data. S. B. prepared and Scientific Reports \| (2021)11:16275\| [URL] nature portfolio 16 www. nature. com/scientificreports/ S. B. , A. B. , B. S. and M. V. analyzed the RNA sequencing data. S. B. , B. S. , M. V. , and M. D. drafted the manuscript that was approved by all authors. Funding Mark Dopson and Mario Vera acknowledge funding from the Swedish Innovation Agency (Vinnova) and the Agencia Nacional de Investigacion y Desarrollo (ANID), respectively under ERA-MIN 2 supported by the European Commission, via the project Microbial Consortia for enhanced Copper Recovery (Mi CCu R). Soren Bellenberg acknowledges funding from DFG (BE 6668/1-1). MV acknowledges funding from FONDECYT/ ANID 1190892 grant. Beatriz Salas acknowledges support from CONICYT/ANID Ph D Scolarship 21200461. Competing interests The authors declare no competing interests. Additional information Supplementary Information The online version contains supplementary material available at [URL] 10. 1038/s41598-021-95324-9. Correspondence and requests for materials should be addressed to S. B. or M. V. Reprints and permissions information is available at www. nature. com/reprints. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affliations. C Open Access This article is licensed under a Creative Commons Attribution 4. 0 International BY License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit [URL] @ The Author(s) 2021 Scientific Reports\| (2021) 11:16275 \| [URL] natureportfolio 17
ARTICLE IN PRESS Waste Management xxx (2015) xxx-xxx Contents lists available at Science Direct Waste Management ELSEVIER journal homepage: www. elsevier. com/locate/wasman Multi-criteria group decision making for evaluating the performance of e-waste recycling programs under uncertainty Santoso Wibowo a,, Hepu Deng b. c Schoolofngineering Technology CQUniversity Melbourne,Austal b School of Business ITLogistics,RMITUniversity,Melbourne,Australa Schoolof Information Resources Management,Renmin University,Beijing,China ARTICLE INFO ABSTRACT Articlehistory: This paper presents a multi-criteria group decision making approach for effectively evaluating the perfor- Received 18 November 2014 mance of e-waste recycling programs under uncertainty in an organization. Intuitionistic fuzzy numbers Accepted 23 February 2015 are used for adequately representing the subjective and imprecise assessments of the decision makers in Available online xxxx evaluating the relative importance of evaluation criteria and the performance of individual e-waste recy- cling programs with respect to individual criteria in a given situation. An interactive fuzzy multi-criteria Keywords: decision making algorithm is developed for facilitating consensus building in a group decision making E-waste recycling programs environment to ensure that all the interest of individual decision makers have been appropriately consid- Intuitionistic fuzzy numbers Multi-criteria analysis ered in evaluating alternative e-waste recycling programs with respect to their corporate sustainability performance. The developed algorithm is then incorporated into a multi-criteria decision support system Group decision making Performance evaluation for making the overall performance evaluation process effectively and simple to use. Such a multi-criteria decision making system adequately provides organizations with a proactive mechanism for incorporating the concept of corporate sustainability into their regular planning decisions and business practices. An example is presented for demonstrating the applicability of the proposed approach in evaluating the performance of e-waste recycling programs in organizations. 2015 Elsevier Ltd. All rights reserved. 1. Introduction (Oguchi et al. , 2013). The popularity of recycling for effectively managing e-waste is due to the benefits that it can provide to End-of-life electrical and electronic equipment, also known as individual organizations. Recycling, for example, is cost effective e-waste, is the fastest growing waste stream in the world nowa- as it can help to reduce the costs of managing and handling waste days at an alarming growth rate of 3-5% per year (Afroz et al. , in the organization. It can reduce the use of land for landfills in a 2013; Dwivedy and Mittal, 2013). Globally, about 30-50 million society which is the common way of waste treatment nowadays. tons of e-waste are disposed each year due to the widespread This in turn can reduce the negative impact of waste through land- adoption of electronics in consumer products and the accelerating fills on the environment (Mulliner et al. , 2013). To be economically technological change in today's dynamic environment (Menikpura viable, environmentally friendly, and socially responsible, organi- et al. , 2014). The increasing amount of e-waste presents a serious zations need to use structured approaches to evaluate the perfor- challenge for organizations in their active pursuit of sustainable mance of existing e-waste recycling programs with respect to the development. As a result, it is critical for individual organizations interest of various stakeholders in a group decision making to adequately adopt appropriate programs and approaches for environment so that the most appropriate e-waste recycling pro- reducing the negative impact of e-waste on the environment. gram can be adopted in a specific situation. Recycling is widely known to be an environmentally-friendly Evaluating the performance of alternative e-waste recycling strategy and the most appropriate approach to effectively manage programs is complex and challenging. It often involves (a) multiple e-waste for minimizing its negative impact on the environment decision makers, (b) multiple evaluation criteria, and (c) subjective and imprecise assessments. Much research has been done on the development of appropriate approaches for evaluating the overall Corresponding author at: 108 Lonsdale Street, Melbourne, Victoria 3000, performance of e-waste recycling programs with respect to the Australia. Tel. : +61 (0)3 8662 0571; fax: +61 (0)3 9639 4800. overall sustainability performance objective of an organization E-mail addresses: [EMAIL] (S. Wibowo), [EMAIL] from different perspectives (Ekmekcioglu et al. , 2010; Kim et al. , (H. Deng). [URL] 0956-053X/@ 2015 Elsevier Ltd. All rights reserved. Please cite this article in press as: Wibowo, S. , Deng, H. Multi-criteria group decision making for evaluating the performance of e-waste recycling programs under uncertainty. Waste Management (2015), http: //dx. doi. org/10. 1016/j. wasman. 2015. 02. 035 ARTICLE IN PRESS 2 S. Wibowo, H. Deng/Waste Management xxx (2015) xxx-xxx 2013; Li and Tee, 2012). Ekmekcioglu et al. (2010), for example, studies above show that the development and adoption of Dss for apply the technique for order preference by similarity to ideal solu- addressing various decision problems is of great benefits in real tion (Deng et al. , 2000) for dealing with the e-waste recycling pro- world settings. There are, however, still various challenges existent gram performance evaluation problem. Linguistic variables are in dealing with real world decision problems, in particular for eval- used to assess the relative importance of all the evaluation criteria uating the performance of available e-waste recycling programs and the performance rating of each e-waste recycling programs including (a) the need for adequately addressing the interest of mul- with respect to each criterion, leading to the development of a tiple decision makers in a multi-criteria decision making environ- weighted fuzzy decision matrix in a given situation. A closeness ment, (b) the presence of the subjectiveness and imprecision coeffcient is calculated for determining the ranking order of all inherent in the human decision making process, and (c) the cogni- the e-waste recycling programs across all the criteria. This tive demand on the decision makers in the decision making process. approach is effective and efficient for solving the e-waste recycling This paper formulates the process of evaluating the perfor- program performance evaluation problem under some circum- mance of e-waste recycling programs as a multi-criteria group stances. It, however, is inflexible in the weight elicitation process decision making problem, and presents a multi-criteria group deci- and very demanding on the consistency checking in the subjective sion making approach for evaluating the performance of e-waste evaluation process. recycling programs under uncertainty in an organization. Kim et al. (2013) propose an integrated approach using Delphi Intuitionistic fuzzy numbers are used for representing the subjec- and the analytic hierarchical process (AHP) (Deng, 1999) for eval- tive and imprecise assessments of the decision makers in eval- uating the performance of the recycling programs under uncer- uating the relative importance of the evaluation criteria and the tainty. The Delphi method is used for identifying the appropriate performance rating of individual e-waste recycling programs with evaluation criteria in order to adequately consider the interest of respect to individual evaluation criteria. An interactive fuzzy various stakeholders in the decision making process. AHP is used multi-criteria decision making algorithm is developed for facilitat- for determining the relative importance of the evaluation criteria ing consensus building in a group decision making environment to and the performance rating of alternative recycling programs. ensure that all the interest of individual decision makers have been The overall performance of each recycling program across all the appropriately considered in evaluating the performance of alterna- criteria is then determined by effectively aggregating the criteria tive e-waste recycling programs with respect to their corporate weights and the performance ratings of the recycling program with sustainability objective. The developed algorithm is then incorpo- respect to individual evaluation criteria based on the utility theory rated into a multi-criteria Dss for making the overall performance (Yeh et al. , 2010; Wibowo and Deng, 2012). The approach is effec- evaluation process effective and simple to use. An example of the tive as it is capable of assessing all the criteria importance in a sys- problem of evaluating the e-waste recycling program performance tematic manner. It, however, suffers from several limitations is presented to demonstrate the applicability of the proposed including the amount of time consumed in applying the Delphi approach for solving real world e-waste recycling program perfor- method for identifying the evaluation criteria and the complexity mance evaluation problem. to use the method for determining the overall ranking of individual In what follows, we first present an overview of the related recycling programs across all the evaluation criteria. research on the performance evaluation of e-waste recycling pro- Li and Tee (2012) develop a mixed integer multi-objective lin- grams. We then present an interactive fuzzy multi-criteria decision ear programming approach for dealing with the problem of eval- making algorithm which is further incorporated in a Dss for solv- uating the performance of e-waste recycling programs. With the ing the problem of evaluating the performance of e-waste recycling use of this approach, the economic, environmental and health per- programs in organizations
aeruginosa) of rifampicin (Fig. 1 and SI Appendix, Fig. S1 E–H). After 35 to 40 generations in culture, the median concentrations of antibiotic- treated cells were able to withstand increased to 3. 2 µg/m L, 820 µg/m L, 1,024 µg/m L, and 512 µg/m L of rifampicin respectively (Fig. 1). This value was significantly lower in cells that had been exposed to thiourea: 0. 3 µg/m L (B. subtilis), 26. 4 µg/m L (S. aureus), 256 µg/ m L (S. enterica), and 20 µg/m L (P. aeruginosa) of rifampicin. The overexpression of kat A in B. subtilis, as well as performing the assay in anaerobiosis in S. aureus and S. enterica, had a similar effect, as the median MIC on the last day of the experiments was 0. 2 µg/m L, 0. 4 µg/m L, and 64 µg/m L of rifampicin respectively (Fig. 1A ). Interestingly, inactivating mutations in another gene (kat E) that codes for a catalase have been found in patient- derived S. enterica serovar Typhimurium strains (21), and this is the case with the strain that we used (ST19) (22). When we performed the same experiment in a strain with a functional Kat E protein (SL1344) (22), which we confirmed has a higher catalase activity (SI Appendix, Fig. S1K ), we observed a reduction in the kinetics of evolution, similar to the addition of thiourea (Fig. 1C). These observations are consistent with endogenous oxidative stress driv - ing evolution generally in bacteria. To test whether this phenomenon is universally conserved and not unique to the transcription inhibitor rifampicin, and because transcription- coupled repair has been shown to promote the evo- lution of antibiotic resistance (15), we performed the same evo- lution assays using three other classes of antibiotics. We observed similar results when we used the translation inhibitor kanamycin and the folate synthesis inhibitor trimethoprim in B. subtilis, as well as the cell wall synthesis inhibitor phosphomycin in S. aureus (SI Appendix, Fig. S2 A–H). Altogether, our results suggest that ROS plays a critical role in evolution across highly divergent bacteria. TCR Drives Oxidative Stress- Dependent Evolution. We next decided to determine the mechanism by which endogenous oxidative stress drives evolution, using the genetically tractable species B. subtilis. Because oxidative DNA damage is commonly repaired by BER, we first tested whether BER mutants have decreased mutation rates, which would correlate with slower evolution of resistance. However, and consistent with previous reports (23, 24), we observed that strains lacking the DNA glycosylases Mut Y and Mut M have higher mutation rates than wild- type cells (SI Appendix, Fig. S3A), suggesting BER is not the source of ROS- induced mutagenesis and evolution. We and others have previously shown that, in the absence of exogenous DNA damage, the bacterial TCR protein Mfd pro- motes mutagenesis across many different bacterial species (15, 25, 26). In addition, we previously showed that this pro- mutagenic effect depends on the interaction of Mfd with the RNA polymer- ase (RNAP) and the NER protein Uvr A (15). Therefore, we decided to focus on NER. This DNA repair pathway has been shown to cause spontaneous mutagenesis in some bacteria (27–29), even though it has a protective effect against mutations when bacteria are exposed to DNA- damaging agents (30, 31). Bacterial NER has traditionally been described as consisting of two subpathways, global genome repair (GGR), whereas transcription- coupled repair (TCR), differing in the damage rec- ognition step (13). In GGR, Uvr A scans the genome and binds DNA to trigger NER, and in TCR it is a stalled RNA polymerase that either through Uvr D or the protein Mfd recruits the NER machinery to the site of DNA damage (32). This model has been put into question by recent studies claiming that, in bacteria, most NER is coupled to transcription and that if any, GGR has a minor role in this process (33, 34). We performed an evolution assay in wild- type B. subtilis cells and in isogenic strains lacking the core component of the NER Downloaded from [URL] by 152. 59. 46. 29 on July 22, 2025 from IP address 152. 59. 46. 29. PNAS 2023 Vol. 120 No. 27 e2300761120 [URL] 3 of 8machinery Uvr A, and we observed that Uvr A promotes the evo- lution of antibiotic resistance (Fig. 2A). In addition, we measured mutation rates using the Luria–Delbruck fluctuation assay (35) in wild- type and mutants for the core NER proteins Uvr A, Uvr B, and Uvr C in the absence of exogenous DNA damage. We observed a 50 to 75% decrease in the mutation rates in NER- deficient strains (Fig. 2B), indicating that NER promotes spontaneous mutagenesis in B. subtilis. To test whether TCR was solely responsible for NER- dependent mutagenesis, we built double mutants that lacked Mfd, and the Uvr proteins. If NER is mutagenic only due to TCR, then we expected that the double mutants lacking Mfd and NER proteins would have an epistatic relationship, and that the effect of the double mutants in mutagenesis and evolution would be similar to the single mutants. On the other hand, if NER- mediated mutagenesis is through both GG- NER and TCR, the combination of mutants lacking both Mfd and NER proteins would have a further reduced mutation rates. To discern between these possi- bilities, we performed evolution and mutation rate assays in B. subtilis cells lacking Mfd, as well as Uvr A and Mfd both and observed a comparable decrease in the evolution of resistance in both single mutants and in the double mutant (Fig. 2A). Consistently, the mutation rates of the single and double mutants side- by- side did not decrease further. We found that the mutation Fig. 1. Oxidative stress drives the evolution of antibiotic resistance. Median concentration of rifampicin that allows for growth in the indicated strains at each sampled timepoint. 50 m M (A–C) or 10 m M (D) thiourea was included in the media when indicated. 1 m M IPTG was added for kat A overexpression. n = 23 (B. subtilis – thiourea, rifampicin), 12 (B. subtilis + thiourea, rifampicin), 24 (B. subtilis kat A overexpression, rifampicin), 12 (S. aureus – thiourea), 12 (S. aureus + thiourea), 12 (S. aureus anaerobiosis), 35 (S. enterica serovar Typhimurium ST19), 34 (S. enterica serovar Typhimurium ST19 + thiourea), 24 (S. enterica serovar Typhimurium SL1344), 12 (S. enterica serovar Typhimurium ST19), 22 (P. aeruginosa – thiourea), 12 (P. aeruginosa + thiourea) biological replicates. Statistical significance was assessed with a two- tailed Mann–Whitney U test, * P < 0. 05. Fig. 2. Transcription- coupled repair promotes mutagenesis. (A) Median rifampicin concentration that allows for growth in the indicated strains at the indicated timepoints. n = 23 (wt), 36 (Δuvr A), 24 (Δmfd), 12 (Δuvr A Δmfd) biological replicates. (B) Mutation rates of B. subtilis strains measured using rifampicin. n = 54 (wt), 48 (Δuvr A), 37 (Δuvr B), 47 (Δuvr B + uvr B), 48 (Δuvr C), 59 (Δmfd), 49 (Δmfd + mfd), 40 (Δmfd Δuvr A), 40 (Δmfd Δuvr B), 50 (Δmfd Δuvr C) biological replicates. Statistical significance was assessed with a two- tailed Mann–Whitney U test, * P < 0. 05. Error bars are 95% CI. Downloaded from [URL] by 152. 59. 46. 29 on July 22, 2025 from IP address 152. 59. 46. 29. 4 of 8 [URL] pnas. orgrates of strains lacking both Mfd and any one of the three canon- ical NER factors have the same mutation rates as each single mutant alone (Fig. 2B). This strongly suggests that all (mutagenic) NER is coupled to transcription. Additionally, we measured mutation rates in S. enterica serovar Typhimurium cells lacking either Uvr B or Mfd and compared them to isogenic wild- type cells. We observed a similar result as in B. subtilis: in the absence of either Uvr B or Mfd there was a similar decrease in mutation rates compared to a wildtype strain. These results suggest that the mutagenicity of TC- NER is con- served in the highly divergent bacteria B. subtilis and S. enterica (SI Appendix, Fig. S3B)
Physiological and genetic characterization of Thiobacillus ferooxidans strains used in Biohydrometallurgy. Mineral processing and Extractive Metallurgy Review, 1998; 19(1): 1677- 1682. [URL] org/10. 1080/08827509608962438 13. Silverman MP and Lundgren DG. Studies on chemoautotrophiic iron bacteria, Thiobacillus ferrooxidans: an improved medium and a harvesting procedure for securing high cellular yields. J. Bacteriol , 1959; 10 (77): 642-647. 14. Sand, W. Ferric iron reduction by Thiobacillus ferrooxidans at extremely low p H-values. Biogeochemistry, 1989; 7: 195-201. 15. Nguyen, Van Khanh. , Lee, Mu Hyun. , Park, Hyung Jun. , Lee, Jong-Un. Bioleaching of arsenic and heavy metals from mine tailings by pure and mixed cultures of Acidithiobacillus spp. Journal of Industrial and Engineering Chemistry, 2015; 21: 451-458. [URL] jiec. 2014. 03. 004 16. Bayat, O. , Sever, E. , Bayat, B. , Arslan, V. and Poole, C. Bioleaching of Zinc and Iron from Steel Plant waste using Acidithiobacillus ferrooxidans. Appl. Biochem. Biotechnol, 2009; 152(1): 117-126. doi: 10. 1007/s12010-008-8257-5. 17. Cwalina, B. , Fischer, H. and Ledakowicz, S. Bacterial leaching of nickel and cobalt from Pentlandite. Physicochemical Problems of Mineral Processing, 2000; 34(1): 17-24. 18. Chen, S. Y. and Lin, J. G. Effect of substrate concentration on bioleaching of metal contaminated sediment. J. Hazard. Mater, 2001; 82(1): 77-89. [URL] 3894(00)00357-5 19. Raquel, B. , Mesquita, R. Antonio O. S. and Rangel, S. Development of Sequential Injection Methodologies for the Spectrophotometric Direct and Kinetic Determination of Aluminum in Natural and Waste Waters. J. Braz. Chem. Soc, 2008; 19 (6): 1171-1179. 20. Demirhan, N. and Fikriye T. E. Spectrophotometric determination of iron (II) with 5-nitro, 6-amino -1, 10 phenathroline. Turk J. Chemistry, 2007; 27: 315-321. 21. Ballester, A. , Gonzalez, F. , Blazquez, M. L. and Barril, M. A. Microbiological leaching of copper from lead mattes. Metallurgical Transactions, 1989; 20 B: 773-779. [URL] BF02670183 22. David Lukumu Bampole, Patricia Luis and Emmanuel Lukumu Mulamba. Effect of substrates during the adaptation of indigenous bacteria in Bioleaching of Sulphide ores. American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS), 2017; 32 (1): 200-214. 23. Haragobinda Srichandan, Ashish Pathak, Dong Jin Kim, and Seoung-Won Lee. Effect of substrate concentration and pulp density on Bioleaching of metals from as received spent refinery catalyst World Academy of Science, Engineering and Technology. International Journal of Biotechnology and Bioengineering , 2014; 8 (8). 16th International Conference on Bioscience, Biotechnology and Biochemistry, Amsterdam, The Netherlands. 24. Pradhan, D. , Pal, S. , Sukla, L. B. , Chaudhury, G. R. and Das, T. Bioleaching of low-grade copper ore using indigenous microorganisms. Indian J. Chem. Technol , 2008; 15: 588-592. 25. Vachon, P. , Tyagi, R. D. , Auchlalr, J. C. and Wilkinson, J. K. Chemical and biological leaching of aluminum from red mud. Environ. Sci. Technol, 1994; 28(1): 26-30. DOI: 10. 1021/ es00050a005 J PURE APPL MICROBIOL, 12(3), SEPTEMBER 2018. 1654 AHMED et al. : IMp Act of pulp DEns Ity on Extr Act Ion of MEt Als 26. Woznick, D. J. and Huang, J. Y. Variables affecting metal removal from sludge. J. Water. Poll. Contr. Fed, 1982; 54 (12): 1574-1580. 27. Park, K. H. , Mohapatra, D. , Reddy, B. R. , Nam, C. W. Hydrometallurgical processing and recovery of molybdenum trioxide from spent catalyst. International Journal of Mineral Processing , 2006; 80 (2): 261–265. [URL] org/10. 1016/j. minpro. 2006. 05. 002. 28. Wadood T. Mohammed, Nada S. Ahmedzeki, Mariam F. Abdul Nabi. Extraction of Valuable Metals From Spent Hydrodesulfurization Catalyst By Two Stage Leaching Method. Iraqi Journal of Chemical and Petroleum Engineering, 2011; 12 (4): 21-35. 29. Abhishek Tripathi, Manoj Kumar, D. C. Sau, Archana Agrawal, Sanchita Chakravarty and T. R. Mankhand. Leaching of Gold from the Waste Mobile Phone Printed Circuit Boards (PCBs) with Ammonium Thiosulphate. International Journal of Metallurgical Engineering, 2012; 1(2): 17-21. DOI: 10. 5923/j. ijmee. 20120102. 02 30. Shariat, M. H. , Setoodeh, N. , Atash Dehghan, R. Optimizing conditions for hydrometallurgical production of purified molybdenum trioxide from roasted molybdenite of Sarcheshmeh. Miner. Eng , 2001; 14: 815–820. [URL] org/10. 1016/S0892-6875(99)00000-X. 31. Duarte, J. C. , Estrada, P. , Beaumont, H. , Sitima, M. and Pereilra, P. Biotreatment of tailings for metal recovery. International Journal of Mine Water, 1990; 9(1-4): 193-206. [URL] org/10. 1007/BF02503692. 32. Kings, E. O. , Ward, M. K. M. , and Raney, D. E. , Two simple media for the demonstration of Pyocyanin and fluorescein. Lab. Clin. Med. 1954; 44: 301-307
Huang et al. Military Medical Research (2018)5:18 [URL] MMR MILITARY MEDICAL RESEARCH REVIEW Open Access Cross Mark and simulated microgravity on microbial growth and secondary metabolism Bing Huangt, Dian-Geng Lilt, Ying Huang2* and Chang-Ting Liu' Abstract Spaceflight and ground-based microgravity analog experiments have suggested that microgravity can affect microbial growth and metabolism. Although the effects of microgravity and its analogs on microorganisms have been studied for more than 50 years, plausible conflicting and diverse results have frequently been reported in different experiments, especially regarding microbial growth and secondary metabolism. Until now, only the responses of a few typical microbes to microgravity have been investigated; systematic studies of the genetic and phenotypic responses of these microorganisms to microgravity in space are still insufficient due to technological and logistical hurdles. The use of diferent test strains and secondary metabolites in these studies appears to have caused diverse and conflicting results. Moreover, subtle changes in the extracellular microenvironments around microbial cells play a key role in the diverse responses of microbial growth and secondary metabolisms. Therefore, "indirect" effects represent a reasonable pathway to explain the occurrence of these phenomena in microorganisms. This review summarizes current knowledge on the changes in microbial growth and secondary metabolism in response to spaceflight and its analogs and discusses the diverse and conflicting results. In addition, recommendations are given for future studies on the effects of microgravity in space on microbial growth and secondary metabolism. Keywords: Microbial growth, Secondary metabolism, Spaceflight, Microgravity, Simulated microgravity, Microgravity analogs Background [21-23], and microbial mutations and relation to adapta- Microbes are highly evolved [1] and can survive in tion to LSMMG [24]. Considerable effort has been fo- many extreme environments [2, 3], including outer cused on cell growth and secondary metabolism. space [4, 5]. However, the different mechanisms by The significance of exploring the effects of space which they respond and adapt to these environments microgravity on microbial growth and metabolism in- (especially to microgravity in space) remain unclear. Re- cludes two important implications. First, the growth of cently, spaceflight and ground simulated microgravity microorganisms (especially pathogenic microbes) in a (SMG) or low-shear modeled microgravity (LSMMG) ex- space capsule could be a threat to astronaut health and periments have demonstrated that microgravity can affect be detrimental to their immune systems [10, 11, 25, 26]. cellular processes and functions in microorganisms, such Second, microorganisms can produce many special sec- as cell growth [6-9], gene expression [10-12], cell morph- ondary metabolites that could be utilized as medicine ology and development [13, 14], virulence and resistance for both humans and animals [5, 23, 27] as well as some [15-18], biofilm formation [19, 20], secondary metabolism toxic secondary metabolites that may threaten the health of astronauts [28]. Investigations into whether the pro- duction of secondary metabolites by these microorganisms * Correspondence: [EMAIL] [EMAIL] is altered in the space environment are worthwhile. t Bing Huang and Dian-Geng Li contributed equally to this work. 2State Key Laboratory of Microbial Resources, Institute of Microbiology. Although studies on the responses of microbes to Chinese Academy of Sciences, Bejing 100101, China microgravity date back to the 1960s, many basic ques- 1Nanlou Respiratory Diseases Department, Chinese PLA General Hospital/ tions concerning the effects of microgravity on microbial Chinese PLA Postgraduate Medical School, Bejing 100853, China BMC @ The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Atribution 4. 0 International License ([URL] which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commonslicense,andindicateifchanc ([URL] applies to the data made available in this article, unless otherwise stated. Huang et al. Military Medical Research (2018)5:18 Page 2 of 14 behavior are far from being fully resolved [29, 30]. More- level (i. e. , the value of equivalent accelerated speed) over, our systematic and in-depth understanding of the needs to be specified in this context. Generally, the genetic and phenotypic responses of a variety of micro- “microgravity" level ranges from approximately 10- 3 to organisms to microgravity environments in space is in- 10-6 g and is dependent on the location within the sufficient due to technological and logistical hurdles. To spacecraft and the frequency of vibrations [33, 34]. date, only a few typical microbes, including streptomy- Therefore, the term “microgravity” has been suggested cetes, have been investigated in terms of their responses to be exclusively restricted to experiments performed in to microgravity and its analogs [29]. Interestingly, plaus- an environment such as drop towers, parabolic flights, ible but conflicting results for cellular growth rates were sounding rockets, recoverable satellites, spaceships, and reported in different spaceflight and clinorotation exper- the space station (spacelab). Furthermore, the usage of iments [31]. In addition to the microbial growth rate, the term “microgravity” should be independent of the secondary metabolism was also found to be similarly sen- interfering factors of the actual acceleration of the sitive to microgravity and simulated microgravity [22, 31]. spacecraft in space and cosmic radiation, while the term Furthermore, the results of these studies have been mixed, "spaceflight” should contain “microgravity” and the other without conclusive assertions and suggestions for future inherent factors in space (i. e. , cosmic radiation). antibiotic production in space environments [22, 32] Generally, each type of spaceflight opportunity has its Thus, nothing conclusive or concrete is known about the own time range of duration and corresponding “micro- effects of microgravity or simulated microgravity on mi- gravity" level based on the various spaceflight technolo- crobial growth and secondary metabolism; thus, this area gies [35] (Table 1). To date, many studies associated of research remains open to further exploration. with the responses of terrestrial life have been conducted In this review, we compare the technological methods in space microgravity conditions by recoverable satellites, of microgravity experiments used for spaceflight and space shuttles and on the space station (spaceship) [4]. ground-based simulated microgravity. We also analyzed The effect of an organism in response to the microgravity the similarities and differences in their effects on micro- of a space experiment in these studies is frequently de- bial growth and secondary metabolism as well as the scribed as the “spaceflight effect”" due to considerations of causes of the inconsistent results. Based on the analysis the interference of cosmic radiation, spacecraft vibrations of previous studies, it is clear that the experiments per- and hypervelocity; the effects of microgravity and space- formed under spaceflight and SMG conditions differed flight are different. Earlier studies often lacked on board in some procedures, including in the use of different controls during spaceflight due to restrictions in the use strains, growth media, and types of ground-based facilities of centrifuges and sample fixation in orbit. Recently, these (GBFs), which may lead to conflicting results. We also drawbacks have been gradually overcome by using an propose that subtle differences in the microenvironment incubator-centrifuge in orbit that could simulate 1 g Earth could play a key role in the diverse responses observed for gravity and thus separate other space environmental fac- microbial growth and secondary metabolism. Finally, we tors during spaceflight. Furthermore, real-time sample fix- provide recommendations for future studies on the effects ation in orbit could avoid the interference of spacecraft of microgravity in a space environment on microbial landing [36, 37]. growth and secondary metabolism. Although some of these studies were conducted in a space environment by means of the spacecraft and space Space microgravity and its analogs on the ground station, microgravity experiments in space are costly and A large proportion of the experiments were performed performed infrequently due to technological and logis- under simulated microgravity conditions using ground- tical hurdles. Hence, several GBFs with different physical based microgravity simulators due to the scarcity and cost- concepts have been constructed to simulate microgravity liness of spaceflight opportunities. However, it should be on the ground [38, 39] (Table 2). The term “simulated noted that the real microgravity in space is not equivalent to microgravity analogs using ground-based simulators. Table 1 Several flight opportunities and their characteristics Therefore, questions remain concerning the similarities Flight opportunities Time of duration Gravity level (g) and relationships between real space microgravity and Drop tower 2-9 s 10-5 - 10-2 simulated microgravity by ground-based simulators. Parabolic flight 15-30 s 10-3 - 10-2 The use of the term “microgravity" in most studies re- fers to the conditions of “weightlessness" or “zero-g" that Sounding rockets 6-15 min 10-4 - 10-3 only exist in a space environment. In fact, microgravity Recoverable satellites/space 1-2 mon 10-5 - 10-3 is labeled “μg", referring to the fact that the gravita- shuttle tional forces are not entirely equal to zero but are just Space station (spacelab) Several years or 10-6 - 10-5 very small and that its corresponding “microgravity' permanent Huang et al
FEMS MICROBIOLOGY REVIEWS ELSEVIER FEMS Microbiology Reviews 20 (1997) 591-604 Bioleaching: metal solubilization by microorganisms Klaus Bosecker * Federal Institutefor Geosciences and Natural Resources(BGR)，Stilleweg 2,D-30655Hannover,Germany Abstract Bioleaching is a simple and effective technology for metal extraction from low-grade ores and mineral concentrates. Metal recovery from sulfide minerals is based on the activity of chemolithotrophic bacteria, mainly Thiobacillus ferrooxidans and T. thiooxidans, which convert insoluble metal sulfides into soluble metal sulfates. Non-sulfide ores and minerals can be treated by heterotrophic bacteria and by fungi. In these cases metal extraction is due to the production of organic acids and chelating and complexing compounds excreted into the environment. At present bioleaching is used essentially for the recovery of copper, uranium and gold, and the main techniques employed are heap, dump and in situ leaching. Tank leaching is practised for the treatment of refractory gold ores. Bioleaching has also some potential for metal recovery and detoxification of industrial waste products, sewage sludge and soil contaminated with heavy metals. Keywords: Bioleaching; Biohydrometallurgy; Metal solubilization; Microorganisms; Bacteria; Fungi; Thiobacillus; Penicillium; Aspergillus Contents 1. Introduction 592 2. Microorganisms 592 2. 1. Thiobacillus 592 2. 2. Leptospirillum 593 2. 3. Thermophilic bacteria 593 2. 4. Heterotrophic microorganisms 593 3. Bioleaching mechanisms 593 3. 1. Direct bacterial leaching 594 3. 2. Indirect bacterial leaching 594 4. Factors influencing bioleaching 595 4. 1. Nutrients 595 4. 2. O2 and CO2 595 4. 3. p H 595 4. 4. Temperature 595 4. 5. Mineral substrate 595 4. 6. Heavy metals 596 4. 7. Surfactants and organic extractants 596 5. Leaching techniques 596 * Tel. : +49 (511) 643-3102; Fax: +49 (511) 643-2304; e-mail: [EMAIL] 0168-6445/ 97/S32. 00 @ 1997 Federation of European Microbiological Societies. Published by Elsevier Science B. V. PIIS0168-6445(97)00036-3 592 K. Bosecker/FEMS Microbiology Reviews 20（1997）591-604 5. 1. Laboratory investigations 596 5. 1. 1. Percolator leaching 596 5. 1. 2. Submerged leaching 597 5. 1. 3. Column leaching. 597 5. 2. Industrial leaching processes 597 5. 2. 1. Dump leaching 598 5. 2. 2. Heap leaching. 598 5. 2. 3. Underground leaching. 598 5. 2. 4. Tank leaching. 598 6. Industrial applications. 599 6. 1. Copper. 600 6. 2. Uranium 600 6. 3. Gold 600 7. Future aspects. 600 7. 1. Industrial waste products 601 7. 2. Heterotrophic leaching 601 7. 2. 1. Biobeneficiation 601 7. 2. 2. Iron 601 7. 2. 3. Bauxite dressing. 601 8. Conclusion 602 References. 602 1. Introduction conditions. Most thiobacilli are chemolithoautotro- phic species which use the carbon dioxide from the Microbial leaching methods are being increasingly atmosphere as their carbon source for the synthesis applied for metal recovery from low-grade ores and of new cell material. The energy derives from the concentrates that cannot be processed economically oxidation of reduced or partially reduced sulfur com- by conventional methods. As is the case with many pounds, including sulfides, elemental sulfur and thio- biotechnological processes such methods may have sulfate, the final oxidation product being sulfate been used since prehistoric times and probably the [2,3]. Greeks and Romans extracted copper from mine Bacterial leaching is carried out in an acid envi- water more than 2000 years ago. However, it has ronment at p H values between 1. 5 and 3 at which been known only for about 50 years that bacteria most metal ions remain in solution. Therefore the are mainly responsible for the enrichment of metals acidophilic species Thiobacillus ferrooxidans and in water from ore deposits and mines [1]. The solu- T. thiooxidans are of particular importance. Other bilization process is called bioleaching and occurs in thiobacilli are also able to oxidize sulfur and sulfides nature wherever suitable conditions are found for the but they grow only at higher p H values at which growth of the ubiquitous bioleaching microorgan- metal ions do not maintain in solution. isms. T. thiooxidans, isolated in 1922 by Waksman and Joffe [4], is well known for its rapid oxidation of elemental sulfur. Other partially reduced sulfur com- 2. Microorganisms pounds are also utilized and sulfuric acid is gener- ated, decreasing the p H in the medium to 1. 5 to 1 2. 1. Thiobacillus and even lower. The intensive sulfuric acid produc- tion leads to a rapid decomposition of rocks so that The bacteria most active in bioleaching belong to acid-soluble metal compounds can pass into solution the genus Thiobacillus. These are Gram-negative, as sulfates. non-spore forming rods which grow under aerobic However, the most important role in bacterial K. Bosecker/FEMS Microbiology Reviews 20 (1997）591-604 593 leaching is played by T. ferrooxidans. This bacterium in the range of 50°C [12]. Ferrous iron is used as the was first isolated in 1947 by Colmer and Hinkle [1] energy source, but growth is observed only in the from acid coal mine drainage. Morphologically the presence of yeast extract [13]. Extremely thermo- cells are identical to T. thiooxidans, but they differ philic bacteria growing at temperatures above 60°C from the latter by the much slower course of the were isolated by Brierley, Norris, Karavaiko and oxidation of elemental sulfur. T. ferrooxidans differs their co-workers [14-16]. Acidianus brierleyi, for- from all other thiobacilli by the fact that besides merly associated with the genus Sulfolobus [17], is a deriving energy from the oxidation of reduced sulfur chemolithoautotrophic, facultatively aerobic, ex- compounds ferrous iron can be used as an electron tremely acidophilic Archaeon growing on ferrous donor. In the absence of oxygen T. ferrooxidans is iron, elemental sulfur and metal sulfdes. Under still able to grow on reduced inorganic sulfur com- anaerobic conditions elemental sulfur is used as an pounds using ferric iron as an alternative electron electron acceptor and is reduced to H2S. Members of acceptor [5]. An excellent overview of the current the genus Sulfolobus are aerobic, facultatively chem- knowledge of this species was provided by Leduc olithotrophic bacteria oxidizing ferrous iron, elemen- and Ferroni [6]. tal sulfur and sulfide minerals. The same compounds Two new species of acidophilic thiobacilli have are used as energy source by Sulfobacillus thermosul- been described by Huber and Stetter [7,8]: T. pros- fidooxidans, a spore-forming facultatively autotro- perus represents a new group of halotolerant metal- phic bacterium. Growth, however, will only occur mobilizing bacteria [7], T. cuprinus is a facultatively in the presence of yeast extract. chemolithoautotrophic bacterium which oxidizes metal sulfides but does not oxidize ferrous iron. 2. 4. Heterotrophic microorganisms This microorganism is described as preferentially mobilizing copper from chalcopyrite [8]. Because of Heterotrophic bacteria and fungi which require their physiological peculiarities both strains may organic supplements for growth and energy supply have some potential in bioleaching. may contribute to metal leaching. As in the case of manganese leaching, metal solubilization may be due 2. 2. Leptospirillum to enzymatic reduction of highly oxidized metal com- pounds [18] or is effected by the production of or- Leptospirillum ferrooxidans is another acidophilic ganic acids (e. g. , lactic acid, oxalic acid, citric acid, obligately chemolithotrophic ferrous iron oxidizing gluconic acid) and by compounds with at least two bacterium, which was first isolated by Markosyan hydrophilic reactive groups (e. g. , phenol derivatives) from mine waters in Armenia [9]. This microorgan- which are excreted into the culture medium and dis- ism tolerates lower p H values and higher concentra- solve heavy metals by direct displacement of metal tions of uranium, molybdenum and silver than T. fer- ions from the ore matrix by hydrogen ions and by rooxidans, but it is more sensitive to copper and the formation of soluble metal complexes and che- unable to oxidize sulfur or sulfur compounds lates [19,20]. The heterotrophic microorganisms do [10,11]. Therefore, by itself, L. ferrooxidans cannot not have any benefit from the metal leaching. attack mineral sulfides
Acosta C, Galleguillos P, Ghorbani Y, Tapia P, Contador Y, Velasquez A, Espoz C, Pinilla C, Demergasso C (2014) Variation in microbial community from predominantly mesophilic to thermotolerant and Conclusions moderately thermophilic species in an industrial copper heap bioleaching operation. Hydrometallurgy 150:281-289 Through this mini-review, the current state of genomics, pro- Allen EE, Tyson GW, Whitaker RJ, Detter JC, Richardson PMBJ (2007) Genome dynamics in a natural archaeal population. PNAS 104: teomics, and metabolomics of bioleaching has been briefly 1883-1888 revised, attempting to show the major impacts of these analyt- Almarcegui RJ, Navarro CA, Paradela A, Albar JP, von Bernath D, Jerez ical methods at industrial-scale bioleaching. Genomics has CA (2014a) Response to copper of Acidithiobacillus ferrooxidans currently impacted the determination of leaching biodiversity ATCC 23270 grown in elemental sulfur. Res Microbiol. doi:10. 1016/j. resmic. 2014. 07. 005 and the development of metabolic models. Metagenomics is Almarcegui RJ, Navarro CA, Paradela A, Albar JP, Von Bernath D, Jerez called to impact the field in the coming future by means of the CA (2014b) New copper resistance determinants in the extremo- analysis of spatial and temporal microbial population dynam- phile Acidithiobacillus ferrooxidans: a quantitative proteomic anal- ics during bioelaching stages using next-generation sequenc- ysis. J Proteome Res 13:946-960. doi:10. 1021/pr4009833 ing technologies, as well as metabolic functional models, Amouric A, Brochier-Armanet C, Johnson DB, Bonnefoy V, Hallberg allowing optimal bioleaching operational design and control. KB (2011) Phylogenetic and genetic variation among Fe(II)-oxidiz- ing acidithiobacilli supports the view that these comprise multiple Proteomics future impacts demand major efforts to unravel species with different ferrous iron oxidation pathways. the functional characterization of the identified proteins, Microbiology 157:111-122. doi:10. 1099/mic. 0. 044537-0 Springer Appl Microbiol Biotechnol Auernik KS, Maezato Y, Blum PH, Kelly RM (2008) The genome se- Druschel GK, Baker BJ, Gihring TM, Banfield JF (2004) Acid mine quence of the metal-mobilizing, extremely thermoacidophilic drainage biogeochemistry at Iron Mountain, California. Geochem archaeon Metallosphaera sedula provides insights into Trans 5(2):13. doi:10. 1186/1467-4866-5-13 bioleaching-associated metabolism. Appl Environ Microbiol 74: Ehrenfeld K, Ugalde J, Aravena A, Loira N, Maass A, Parada P, Badilla R 682-692. doi:10. 1128/AEM. 02019-07 (2012) Array of nucleotidic sequences for the detection and identi- Ball P (2013) Celebrate the unknowns. Nature 496:419-420 fication of genes that codify proteins with activities relevant in bio- Barreto M, Jedlicki E, Holmes DS (2005) Identification of a gene cluster technology present in a microbiological sample, and method for for the formation of extracellular polysaccharide precursors in the using this array. U. S. Patent No. US8207324 B2 chemolithoautotroph Acidithiobacillus ferrooxidans. Appl Environ Fischer CR, Wilmes P, Bowen BP, Northen TR, Banfield JF (2012) Microbiol 71:2902-2909 Deuterium-exchange metabolomics identifies N-methyl lyso phos- Belnap CP, Pan C, Denef VJ, Samatova NF, Hettich RL, Banfield JF phatidylethanolamines as abundant lipids in acidophilic mixed mi- (2011) Quantitative proteomic analyses of the response of acidophil- crobial communities. Metabolomics 8:566-578 ic microbial communities to different p H conditions. ISME J 5: Friedman SM, Oshima T (1989) Polyamines of sulfur-dependent 1152-1161. doi:10. 1038/ismej. 2010. 200 archaebacteria and their role in protein synthesis. J Biochem 105: Belnap CP, Pan C, Ver Berkmoes NC, Power ME, Samatova NF, Carver 1030-1033 RL, Hettich RL, Banfield JF (2010) Cultivation and quantitative Fuitterer O, Angelov A, Liesegang H, Gottschalk G, Schleper C, Schepers B, Dock C, Antranikian G, Liebl W (2004) Genome sequence of proteomic analyses of acidophilic microbial communities. ISME J 4:520-530. doi:10. 1038/ismej. 2009. 139 Picrophilus torridus and its implications for life around p H 0. Proc Natl Acad Sci U S A 101:9091-9096. doi:10. 1073/pnas. Bobadilla-Fazzini RA, Cortes MP, Padilla L, Maturana D, Budinich M, Maass A, Parada P (2013) Stoichiometric modeling of oxidation of 0401356101 Garcia DE, Baidoo EE, Benke PI, Pingitore F, Tang YJ, Villa S, Keasling reduced inorganic sulfur compounds (Riscs) in Acidithiobacillus thiooxidans. Biotechnol Bioeng 110:2242-2251. doi:10. 1002/bit. JD (2008) Separation and mass spectrometry in microbial metabo- 24875 lomics. Curr Opin Microbiol 11(3):233-239 Gehrke T, Telegdi J, Thierry D, Sand W (1998) Importance of extracel- Bobadilla-Fazzini RA, Levican G, Parada P (2011) Acidithiobacillus thiooxidans secretome containing a newly described lipoprotein lular polymeric substances from Thiobacillus ferrooxidans for bioleaching. Appl Environ Microbiol 64:2743-2747 Licanantase enhances chalcopyrite bioleaching rate. Appl Gjersing EL, Herberg JL, Horn J, Schaldach CM, Maxwell RS (2007) Microbiol Biotechnol89:771-780. doi:10. 1007/s00253-010-3063- NMR metabolomics of planktonic and biofilm modes of growth in 8 Pseudomonas aeruginosa. Anal Chem 79:8037-8045 Bonnefoy V, Holmes DS (2012) Genomic insights into microbial iron Goh KM, Gan HM, Chan KG, Chan GF, Shahar S, Chong CS, Kahar oxidation and iron uptake strategies in extremely acidic environ- UM, Chai KP (2014) Analysis of Anoxybacillus genomes from the ments. Environ Microbiol 14:1597-1611. doi:10. 1111/j. 1462- aspects of lifestyle adaptations, prophage diversity, and carbohy- 2920. 2011. 02626. x Cardenas JP, Valdes J, Quatrini R, Duarte F, Holmes DS (2010) Lessons drate metabolism. PLo S One. doi:10. 1371/journal. pone. 0090549 Golyshina OV, Yakimov MM, Lunsdorf H, Ferrer M, Nimtz M, Timmis from the genomes of extremely acidophilic bacteria and archaea KN, Wray V, Tindall BJ, Golyshin PN (2009) Acidiplasma aeolicum with special emphasis on bioleaching microorganisms. Appl gen. nov. , sp. nov. , a euryarchaeon of the family Ferroplasmaceae Microbiol Biotechnol. doi:10. 1007/s00253-010-2795-9 isolated from a hydrothermal pool, and transfer of Ferroplasma Chen L, Ren Y, Lin J, Liu X, Pang X, Lin J (2012) Acidithiobacillus cupricumulans to Acidiplasma cupricumulans comb. nov. Int J caldus sulfur oxidation model based on transcriptome analysis be- Syst Evol Microbiol 59:2815-2823. doi:10. 1099/ijs. 0. 009639-0 tween the wild type and sulfur oxygenase reductase defective mu- Guo L, Bruigger K, Liu C, Shah SA, Zheng H, Zhu Y, Wang S, Lillestol tant. PLo S One 7:e39470. doi:10. 1371/journal. pone
Journal of Hazardous Materials 162 (2009) 812-818 Contents lists available at Science Direct Journal of Hazardous Materials ELSEVIER journal homepage: www. elsevier. com/locate/jhazmat Effects of water-washing pretreatment on bioleaching of heavy metals from municipal solid waste incinerator fly ash Qunhui Wanga,, Jie Yangb, Qi Wang , Tingji Wu d a Department of Environmental Engineering,Universityof Science and Technology Beijing,30 Xueyuan Road,Haidian,Beijing100083,China b Shanghai Academy of Environmental Sciences,508 Qinzhou Road,Shanghai 200233,China Chinese Research Academyof Environmental Science,eijing100012,China d Schoolof Municipaland Environmental Engineering,Harbin Institute of Technology,202Haihe Road,Nangang,Harbin150090,China ARTICLEINFO ABSＴRACT Articlehistory: Previous studies demonstrated that the bioleaching of municipal solid waste incinerator fly ash by Received 21 July 2007 Aspergillus niger was an efficient “green technology" for heavy metals removal, however, it demanded Received in revised form 9 March 2008 a long operational period. In this study, water-washing was used as a fly ash pretreatment before the Accepted 22 May 2008 bioleaching process (one-step and two-step). This pretreatment extracted 50. 6% of K, 41. 1% of Na, 5. 2% of Available online 2 July 2008 Ca and 1% of Cr from the fly ash. Due to the dissolution of alkali chlorides which hold particles together, fly ash particles were smashed into smaller granules by the hydraulic flushing action caused by vibration. Keywords: After the pretreatment, the lag phase and bioleaching period were reduced by 45 and 30%, respectively, Heavy metals Bioleaching in one-step bioleaching of 1% (w/v) fly ash. Meanwhile, the metals extraction yield both in one-step and Water-washing pretreatment t Wo-step bioleaching was increased markedly, e. g. in two-step bioleaching, 96% Cd, 91% Mn, 73% Pb, 68% Aspergillus niger Zn, 35% Cr and 30% Fe was extracted from 1% water-washed fly ash, respectively. The reduction of the Fly ash bioleaching period and improvement of metals extraction yield willikely allow the practical application of the bioleaching technology for heavy metals removal from fly ash. ① 2008 Elsevier B. V. All rights reserved. 1. Introduction reagents, and produce final products that exhibit the leaching behavior. Therefore, it is necessary to investigate an economical Considering the lack of landfill space and the contamination and efficient green technology for both the detoxification and the to environment, municipal solid waste (Ms W) is usually inciner- metals recovery from FA. ated to reduce its volume and provide energy. However, the fly ash The application of bioleaching technology, a pollution-less (abbreviated to FA in the following text) collected from the flue gas approach with low cost and low energy consumption, used for by the air pollution control (APC) devices [1] is potentially harmful metals extraction from low-grade ores, soil or mine tailings by to the environment due to the existence of leachable heavy metals chemolithotrophic bacteria, heterotrophic bacteria or fungi, has (e. g. Cd, Cr, Mn and Pb). Therefore, the MSW incinerator (MSWI) FA been reported [5-9]. Thiobacillus thiooxidans and Thiobacillus fer- is classified as a kind of hazardous waste in China. The toxic heavy rooxidans are commonly used for the bioleaching of sulfide minerals metals leached from FA contaminate soil and groundwater when [10,11]. Furthermore, the bioleaching of FA using a pure or mixed water flows through the uncontrolled landfill of FA. FA can also culture of these two Thiobacillus spp. has been investigated inten- be identified as “artificial ore" [2] considering various recoverable sively [12,13]. metals in it (e. g. Cu, Zn and Fe). It is well known that Aspergillus niger metabolites various Conventional treatments of Ms WI FA such as immobiliza- organic acids such as citric, oxalic and gluconic acid by aerobic fer- tion with construction materials [1], chemical washing [3] and mentation using carbon sources. The safety of this fungus allows chloride evaporation [4] have been reported. Whereas, they gen- its application in the industrial fermentation of citric, oxalic or erally demand high energy, require the use of hazardous chemical gluconic acids serving as the raw materials for food, pharmaceu- ticals and other industrial fields [14,15]. The bio-produced organic acids may be used as leaching agents to extract metals from fly ash. In 1996, Bosshard et al. [2] reported the bioleaching of MSWI Corresponding author at: Department of Environmental Engineering, Univer- fly ash by A. niger for the first time. The main agreed mechanisms sity of Science and Technology Beijing, 30 Xueyuan Road, Haidian District, Beijing 100083, China. Tel. : +86 10 62332778; fax: +86 10 62332778. of bioleaching were described as: (i) acidolysis; (i) complexoly- E-mail address: [EMAIL] (Q. Wang). sis; (ii) redoxolysis; (iv) bioaccumulation [2,5]. Wu and Ting [5] 0304-3894/$s - see front matter @ 2008 Elsevier B. V. All rights reserved. doi:10. 1016/j. jhazmat. 2008. 05. 125 Q. Wang et al. / Journal of Hazardous Materials 162 (2009) 812-818 813 investigated the metals extraction efficiency from fly ash by A. Table 2 Chemical component in raw FA (analyzed by XRF) niger using one-step and two-step bioleaching at various fly ash concentrations and compared them with the chemical leaching Component Content (%) using commercial organic and inorganic acids. Xu and Ting [16] Cao 24. 36 optimized the bioleaching conditions using the central composite Si O2 22. 04 design (CCD) and obtained empirical models. According to these C1 9. 20 studies, the acidolysis of bio-produced organic acids was consid- SO3 8. 90 Al2O3 7. 79 ered as the principal mechanism in fungal bioleaching process. K20 7. 43 Therefore, A. niger may be used in the bioleaching of heavy metals Na20 5. 45 from fly ash both in the one-step bioleaching (incubating the fungus Fe203 5. 17 with the fly ash) and the two-step bioleaching (pre-culturing the Mgo 3. 72 fungus for a couple of days before adding in the fly ash). Neverthe- P205 2. 52 Ti O2 less, the bioleaching of fly ash by A niger demand a long operational 1. 50 Zn O 0. 77 period of approximately 15-40 days [2,5,16]. Pbo 0. 34 Water-extractable alkali chlorides (e. g. Na Cl, KCl and Ca Cl2) are Mn O 0. 20 abundant in MSWI FA. The amphoteric heavy metals in FA such Cr203 0. 13 Ba O 0. 11 as Pb and Zn can also be extracted by water [17]. Hence, the water- Washing pretreatment of FA before bioleaching process may reduce Cuo 0. 10 Sr O 0. 08 toxicities of FA to A. niger due to the extraction of chlorides, leach- Br 0. 07 able salts, and amphoteric heavy metals, consequently reduce the Sn O2 0. 07 bioleaching period. Nio 0. 02 The purpose of this study was to introduce the water-washing CO2O3 0. 02 pretreatment of the FA that might reduce the bioleaching period and improve the metals extraction yield. In this study, the FA was washed by deionized water before the bioleaching process. in the raw FA due to the addition of the lime powder into the flue The raw FA (i. e. the FA without water-washing pretreatment) gas. Al, K, Fe, Na and Mg were all above 10 mg/g. Some toxic heavy and the water-washed FA were bioleached by A. niger both in metals, such as Cd, Cr, Cu, Mn, Zn and Pb were less than 10 mg/g. one-step and two-step bioleaching at various FA concentrations. Furthermore, the X-ray fluorescence (XRF, SHIMADZU XRF-1700) The chemical and physical characteristics of the raw FA and the analysis of the raw FA (Table 2) indicates that Ca O and Si O2 were water-washed FA were compared. The p H values of the bioleach- the major compounds, and other metal elements formed mainly in ing suspensions were monitored. The metabolic organic acids oxides. and heavy metals in suspensions after bioleaching were also The BET surface area and the total pore volume of the raw analyzed. FA (analyzed using ASAP2020 surface area and porosity analyzer, Micromeritics) was 8. 57 m2/g and 0. 01126 cm3/g, respectively. 2. Materials and methods These results were in a good agreement with that in Xu and Ting (5. 75 m2/g and 0
J. 441: lipid droplets in yeast. J. Cell Biol. 180: 473-482. 255-264. Gasch, A. P. , P. T. Spellman, C. M. Kao, O. Carmel-Harel, M. B. Hughes, T. R. , M. J. Marton, A. R. Jones, C. J. Roberts, R. Stoughton Eisen et al. , 2000 Genomic expression programs in the re- et al. , 2000a Functional discovery via a compendium of ex- sponse of yeast cells to environmental changes. Mol. Biol. Cell pression profiles. Cell 102: 109-126. 11: 4241-4257. Hughes, T. R. , C. J. Roberts, H. Dai, A. R. Jones, M. R. Meyer et al. , Ghaemmaghami, S. , W. K. Huh, K. Bower, R. W. Howson, A. Belle 2000b Widespread aneuploidy revealed by DNA microarray et al. , 2003 Global analysis of protein expression in yeast. Na- expression profiling. Nat. Genet. 25: 333-337. ture 425: 737-741. Ingolia, N. T. , S. Ghaemmaghami, J. R. Newman, and J. S. Weissman, Giaever, G. , D. D. Shoemaker, T. W. Jones, H. Liang, E. A. Winzeler 2009 Genome-wide analysis in vivo of translation with nucle- et al. , 1999 Genomic profiling of drug sensitivities via induced otide resolution using ribosome profiling. Science 324: 218- haploinsufficiency. Nat. Genet. 21: 278-283. 223. Giaever, G. , A. M. Chu, L. Ni, C. Connelly, L. Riles et al. , Ito, T. , T. Chiba, R. Ozawa, M. Yoshida, M. Hattori et al. , 2001 A 2002 Functional profiling of the Saccharomyces cerevisiae ge- comprehensive two-hybrid analysis to explore the yeast protein nome. Nature 418: 387-391. interactome. Proc. Natl. Acad. Sci. USA 98: 4569-4574. Giaever, G. , P. Flaherty, J. Kumm, M. Proctor, C. Nislow et al. , Jorgensen, P. , J. L. Nishikawa, B. J. Breitkreutz, and M. Tyers, 2004 Chemogenomic profiling: identifying the functional in- 2002 Systematic identification of pathways that couple cell teractions of small molecules in yeast. Proc. Natl. Acad. Sci. USA growth and division in yeast. Science 297: 395-400. 101:793-798. Kedersha, N. , and P. Anderson, 2009 Regulation of translation by Gibney, P. A. , C. Lu, A. A. Caudy, D. C. Hess, and D. Botstein, stress granules and processing bodies. Prog. Mol. Biol. Transl. 2013 Yeast metabolic and signaling genes are required for Sci. 90: 155-185. heat-shock survival and have little overlap with the heat-induced Ketela, T. , L. E. Heisler, K. R. Brown, R. Ammar, D. Kasimer et al. , genes. Proc. Natl. Acad. Sci. USA 110: E4393-E4402. 2011 A comprehensive platform for highly multiplexed mam- Goffeau, A. , 200o Four years of post-genomic life with 6,000 malian functional genetic screens. BMC Genomics 12: 213. yeast genes. FEBS Lett. 480: 37-41. Kloimwieder, A. , and F. Winston, 2011 A screen for germination Gresham, D. , V. M. Boer, A. Caudy, N. Ziv, N. J. Brandt et al. , mutants in Saccharomyces cerevisiae. G3 (Bethesda) 1: 143- 2011 System-level analysis of genes and functions affecting 149. survival during nutrient starvation in Saccharomyces cerevisiae. Krogan, N. J. , G. Cagney, H. Yu, G. Zhong, X. Guo et al. , Genetics 187: 299-317. 2006 Global landscape of protein complexes in the yeast Sac- Griffith, J. L. , L. E. Coleman, A. S. Raymond, S. G. Goodson, W. S. charomyces cerevisiae. Nature 440: 637-643. Pittard et al. , 2003 Functional genomics reveals relationships Kumar, A. , K. H. Cheung, N. Tosches, P. Masiar, Y. Liu et al. , between the retrovirus-like Tyl element and its host Saccharo- 2002 The TRIPLES database: a community resource for yeast myces cerevisiae. Genetics 164: 867-879. molecular biology. Nucleic Acids Res. 30: 73-75. Haass, F. A. , M. Jonikas, P. Walter, J. S. Weissman, Y. N. Jan et al. , Kushner, D. B. , B. D. Lindenbach, V. Z. Grdzelishvili, A. O. Noueiry, 2007 Identification of yeast proteins necessary for cell-surface S. M. Paul et al. , 2003 Systematic, genome-wide identification function of a potassium channel. Proc. Natl. Acad. Sci. USA 104: of host genes affecting replication of a positive-strand RNA vi- 18079-18084. rus. Proc. Natl. Acad. Sci. USA 100: 15764-15769. Hall, M. N. , and P. Linder, 1993 The Early Days of Yeast Genetics, Lehner, K. R. , M. M. Stone, R. A. Farber, and T. D. Petes, Cold Spring Harbor Laboratory Press, Plainview, NY. 2007 Ninety-six haploid yeast strains with individual disrup- Hanscho, M. , D. E. Ruckerbauer, N. Chauhan, H. F. Hofbauer, S. tions of open reading frames between YOR097C and YOR192C, Krahulec et al. , 2012 Nutritional requirements of the BY series constructed for the Saccharomyces genome deletion project, of Saccharomyces cerevisiae strains for optimum growth. FEMS have an additional mutation in the mismatch repair gene Yeast Res. 12: 796-808. MSH3. Genetics 177: 1951-1953. Hartman, J. L. , IV, and N. P. Tippery, 2004 Systematic quantifica- Li, S. C. , and P. M. Kane, 2009 The yeast lysosome-like vacuole: tion of gene interactions by phenotypic array analysis. Genome endpoint and crossroads. Biochim. Biophys. Acta 1793: 650- Biol 5: R49. 663. Large-Scale Phenotypic Screening 463 Li, Z. , F. J. Vizeacoumar, S. Bahr, J. Li, J. Warringer et al. , evisiae gene-deletion mutants in pooled cultures. Nat. Protoc. 2: 2011 Systematic exploration of essential yeast gene function 2958-2974. with temperature-sensitive mutants. Nat. Biotechnol. 29: 361- Richard, P. , and J. L. Manley, 2009 Transcription termination by 367. nuclear RNA polymerases. Genes Dev. 23: 1247-1269. Luban, C. , M. Beutel, U. Stahl, and U. Schmidt, 2005 Systematic Richie, D. L. , K. V. Thompson, C. Studer, V. C. Prindle, T. Aust et al. , screening of nuclear encoded proteins involved in the splicing 2013 Identification and evaluation of novel acetolactate syn- metabolism of group I introns in yeast mitochondria. Gene 354: thase inhibitors as antifungal agents. Antimicrob. Agents Che- 72-79. mother. 57: 2272-2280. Lui, J. , S. G. Campbell, and M. P. Ashe, 2010 Inhibition of trans- Robinson, D. G. , W. Chen, J. D. Storey, and D. Gresham, lation initiation following glucose depletion in yeast facilitates 2014 Design and analysis of Bar-seq experiments. G3 (Be- a rationalization of m RNA content. Biochem. Soc. Trans. 38: thesda) 4: 11-18. 1131-1136. Ross-Macdonald, P. , P. S. Coelho, T. Roemer, S. Agarwal, A. Kumar Lum, P. Y. , C. D. Armour, S. B. Stepaniants, G. Cavet, M. K. Wolf et al. , 1999 Large-scale analysis of the yeast genome by trans- et al. , 2004 Discovering modes of action for therapeutic com- poson tagging and gene disruption. Nature 402: 413-418. pounds using a genome-wide screen of yeast heterozygotes. Cell Ryan, O. , R. S. Shapiro, C. F
European Food Safety Authority (EFSA) (2018). ‘Guidelines on EFSA Consultations’. EFSA Supporting Publications 15(3):1390E. European Food Safety Authority (EFSA) Scientific Committee (2017). ‘Guidance on the use of the weight of evidence approach in scientific assessments’. EFSA Journal 15(8):e04971. European Network of Scientists for social and environmental responsibility (ENSSER) (2017). Statement on New Genetic Modification Techniques. Available at: [URL] Evolva (2018). Vanillin. Available at: [URL] (Accessed: 1 June 2018). Ewen, J. G. (2012). Reintroduction biology: integrating science and management. John Wiley & Sons. [URL] org/10. 1002/9781444355833 Federal Register (1978). Federal Register: 42 Fed. Reg. 57683 (Nov. 4, 1977). Feil, R. and Fraga, M. F. (2012). ‘Epigenetics and the environment: emerging patterns and implications’. Nature reviews genetics 13(2):97. Ferraro, P. J. and Pattanayak, S. K. (2006). ‘Money for Nothing. A Call for Empirical Evaluation of Biodiversity Conservation Investments’. PLo S Biology 4(4):e105. [URL] Feschotte, C. and Pritham, E. J. (2007). ‘DNA Transposons and the Evolution of Eukaryotic Genomes’. Annual Review of Genetics 41(1):331–368. [URL] Foundation for the National Institutes of Health (FNIH) (2018a). Gene Drive Research Consortium. Available at: [URL] do/current-research-programs/gene-drive-research-consortium (Accessed: 25 July 2018). Foundation for the National Institutes of Health (FNIH) (2018b). ‘Gene Drive Research Sponsors and Supporters Forum’. Available at: [URL] Finless Foods (2018). Finless Foods. Fisher, E. C. , Jones, J. S. and von Schomberg, R. (2006). Implementing the precautionary principle: perspectives and prospects. Edward Elgar Publishing. [URL] Fisher, M. C. , Henk, D. A. , Briggs, C. J. , Brownstein, J. S. , Madoff, L. C. , Mc Craw, S. L. and Gurr, S. J. (2012). ‘Emerging fungal threats to animal, plant and ecosystem health’. Nature 484:186–194. [URL] Fisher, M. C. and Garner, T. W. (2007). ‘The relationship between the emergence of Batrachochytrium dendrobatidis, the international trade in amphibians and introduced amphibian species’. Fungal Biology Reviews 21:2–9. [URL] Fisher, M. C. , Garner, T. W. J. and Walker, S. F. (2009). ‘Global emergence of Batrachochytrium dendrobatidis and amphibian chytridiomycosis in space, time, and host’. Annual Review of Microbiology 63:291–310. [URL] micro. 091208. 073435 Fister, A. S. , Landherr, L. , Maximova, S. N. and Guiltinan, M. J. (2018). ‘Transient expression of CRISPR/Cas9 machinery targeting Tc NPR3 enhances defense response in Theobroma cacao’. Frontiers in Plant Science 9:268. [URL] Flajnik, M. F. (2018). ‘A cold-blooded view of adaptive immunity’. Nature Reviews Immunology 18:438–453. [URL] s41577-018-0003-9 Fleischer, R. C. , James, H. F. and Olson, S. L. (2008). ‘Convergent Evolution of Hawaiian and Australo-Pacific Honeyeaters from Distant Songbird Ancestors’. Current Biology 18(24):1927–1931. [URL] Foley, J. A. , De Fries, R. , Asner, G. P. , Barford, C. , Bonan, G. , Carpenter, S. R. , Chapin, F. S. , Coe, M. T. , Daily, G. C. , Gibbs, H. K. , Helkowski, J. H. , Holloway, T. , Howard, E. A. , Kucharik, C. J. , Monfreda, C. , Patz, J. A. , Prentice, C. , Ramankutty, N. and Snyder, P. K. (2005). ‘Global consequences of land use’. Science 309(5734):570–574. [URL] Fontaine, M. C. , Pease, J. B. , Steele, A. , Waterhouse, R. M. , Neafsey, D. E. , Sharakhov, I. V. , Jiang, X. , Hall, A. B. , Catteruccia, F. , Kakani, E. , Mitchell, S. N. , Wu, Y. -C. , Smith, H. A. , Love, R. R. , Lawniczak, M. K. , Slotman, M. A. , Emrich, S. J. , Hahn, M. W. and Besansky, N. J. (2015). ‘Extensive introgression in a malaria vector species complex revealed by phylogenomics’. Science 347(6217). [URL] Food and Agriculture Organization of the United Nations (FAO) (2017). The State of food and agriculture: Leveraging food systems for inclusive rural transformation. [URL] Food and Agriculture Organization of the United Nations (FAO) (2016). Food and Agriculture: Key to achieving the 2030 Agenda for Sustainable Development. Food and Drug Administration (FDA) (2017a). Clarification of FDA and EPA Jurisdiction over Mosquito-Related Products. United States. Food and Drug Administration (FDA) (2017b). Regulation of intentionally altered genomic DNA in animals. United States. Fortini, L. B. , Vorsino, A. E. , Amidon, F. A. , Paxton, E. H. and Jacobi, J. D. (2015). ‘Large-scale range collapse of Hawaiian forest birds under climate change and the need 21st century conservation options’. Plo S one 10(10):e0140389. [URL] pone. 0144311 Foster, A. and Pummill, A. (2011). ‘Saving the Honeybees: A Synthetic Biology Approach’. Missouri University of Science and Technology. Francis (2015). Laudato Si: On Care for our Common Home. Encyclial Letter doi: 10. 1017/S000358150009199X Frankham, R. (2015). ‘Genetic rescue of small inbred populations: meta‐analysis reveals large and consistent benefits of gene flow’. Molecular Ecology 24(11):2610–2618. [URL] Friends of the Earth (FOE) (2012). ‘The Principles for the Oversight of Synthetic Biology’. Elsevier, pp. 1–20. Available at: www. foe. org/ news/blog/2012-03-global-coalition-calls-oversight-synthetic-biology. Fritsche, S. , Poovaiah, C. , Mac Rae, E. and Thorlby, G. (2018). ‘A New Zealand Perspective on the Application and Regulation of Gene Editing’. Frontiers in Plant Science 9:1323. [URL] Fuentes‐Pardo, A. P. and Ruzzante, D. E. (2017). ‘Whole‐genome sequencing approaches for conservation biology: Advantages, limitations and practical recommendations’. Molecular Ecology 26(20):5369–5406. [URL] Fuller, L. , Marzano, M. , Peace, A. , Quine, C. P. and Dandy, N. (2016). ‘Public acceptance of tree health management: Results of a national survey in the UK’. Environmental Science & Policy 59:18–25. [URL] Gales, N. (2011). ‘Humpback whales: status in the southern hemisphere’. Journal of Cetacean Research and Management (Special Issue 3). Available at: [URL] International Whaling Commission. Galloway, T. S. , Cole, M. and Lewis, C. (2017). ‘Interactions of microplastic debris throughout the marine ecosystem’. Nature ecology & evolution 1(5):116. [URL] Gallup, J. and Sachs, J. (2001). The economic burden of malaria. Supplement to Volume 64(1) of the American Journal of Tropical Medicine and Hygiene 64(1):85–96. [URL] Gannon, F. (2001). ‘The essential role of peer review’. EMBO reports 2(9):743. Gantz, V. M. , Jasinskiene, N. , Tatarenkova, O. , Fazekas, A. , Macias, V. M. , Bier, E. and James, A. A. (2015). ‘Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi’. Proceedings of the National Academy of Sciences 112(49):E6736–E6743
72703 3. 15368 88. 68359 86 3184 8. 55 1. 04680 1. 05860 91. 86331 3. 21994 91. 90353 87 3251 8. 65 1. 04420 1. 03040 94. 02473 3. 20791 95. 11144 88 3228 8. 75 1. 01330 1. 03360 96. 21128 3. 29270 98. 40414 89 3462 8. 85 1. 06230 1. 05060 98. 42296 3. 42379 101. 82793 90 3542 8. 95 1. 06270 1. 05570 100. 65977 3. 51860 105. 34654 91 3486 9. 05 1. 02290 1. 03820 102. 92172 3. 53803 108. 88457 92 3599 9. 15 1. 03310 1. 02340 105. 20880 3. 56510 112. 44966 93 3577 9. 25 1. 00470 1. 00410 107. 52101 3. 57474 116. 02440 94 3503 9. 35 0. 96300 0. 96290 109. 85835 3. 50258 119. 52698 95 3497 9. 45 0. 94110 0. 95320 112. 22083 3. 54186 123. 06884 96 3695 9. 55 0. 97370 0. 96060 114. 60844 3. 64530 126. 71414 97 3698 9. 65 0. 95440 0. 95100 117. 02118 3. 68484 130. 39898 98 3677 9. 75 0. 92960 0. 95040 119. 45906 3. 75923 134. 15821 99 3977 9. 85 0. 98510 0. 96230 121. 92207 3. 88478 138. 04299 100 3971 9. 95 0. 96400 0. 97700 124. 41021 4. 02462 142. 06761 101 4099 10. 05 0. 97530 0. 97020 126. 92348 4. 07734 146. 14495 102 4185 10. 15 0. 97630 0. 97610 129. 46189 4. 18418 150. 32912 103 4301 10. 25 0. 98390 0. 99360 132. 02543 4. 34353 154. 67266 104 4533 10. 35 1. 01700 0. 99530 134. 61410 4. 43627 159. 10893 105 4457 10. 45 0. 98090 1. 00650 137. 22791 4. 57330 163. 68223 106 4786 10. 55 1. 03340 1. 02040 139. 86685 4. 72562 168. 40785 107 4881 10. 65 1. 03420 1. 02740 142. 53092 4. 84867 173. 25652 108 4787 10. 75 0. 99550 1. 00840 145. 22012 4. 84879 178. 10531 109 4942 10. 85 1. 00890 1. 00300 147. 93446 4. 91297 183. 01828 110 5066 10. 95 1. 01540 1. 01850 150. 67393 5. 08128 188. 09956 111 5207 11. 05 1. 02490 1. 01920 153. 43853 5. 17807 193. 27762 112 5232 11. 15 1. 01140 1. 01660 156. 22826 5. 25876 198. 53638 113 5345 11. 25 1. 01500 1. 01530 159. 04313 5. 34667 203. 88305 114 5444 11. 35 1. 01560 1. 01000 161. 88313 5. 41373 209. 29678 115 5399 11. 45 0. 98970 0. 99350 164. 74826 5. 41954 214. 71632 116 5439 11. 55 0. 97990 0. 98180 167. 63853 5. 44968 220. 16600 117 5561 11. 65 0. 98470 0. 98010 170. 55392 5. 53485 225. 70085 118 5632 11. 75 0. 98040 0. 98480 173. 49445 5. 65728 231. 35812 119 5822 11. 85 0. 99640 0. 99860 176. 46012 5. 83461 237. 19274 120 6004 11. 95 1. 01050 0. 99840 179. 45091 5. 93231 243. 12505 S7 121 5892 12. 05 0. 97520 0. 98630 182. 46684 5. 95891 249. 08396 122 6044 12. 15 0. 98400 0. 98500 185. 50790 6. 05024 255. 13419 123 6247 12. 25 1. 00050 0. 98970 188. 57410 6. 17959 261. 31378 124 6199 12. 35 0. 97680 0. 98840 191. 66543 6. 27264 267. 58642 125 6392 12. 45 0. 99110 0. 98230 194. 78189 6. 33529 273. 92171 126 6460 12. 55 0. 98570 0. 99560 197. 92348 6. 52463 280. 44634 127 6694 12. 65 1. 00540 0. 99190 201. 09020 6. 60439 287. 05073 128 6627 12. 75 0. 97970 0. 99310 204. 28206 6. 71733 293. 76806 129 6844 12. 85 0. 99610 0. 98470 207. 49905 6. 76541 300. 53347 130 6876 12. 95 0. 98540 0. 99710 210. 74118 6. 95764 307. 49110 131 7172 13. 05 1. 01210 1. 00170 214. 00843 7. 09810 314. 58921 132 7228 13. 15 1. 00460 1. 01230 217. 30082 7. 28357 321. 87278 133 7396 13. 25 1. 01250 1. 00650 220. 61834 7. 35240 329. 22518 134 7377 13. 35 0. 99480 0. 99680 223. 96100 7. 39187 336. 61705 135 7381 13. 45 0. 98060 0. 98090 227. 32879 7. 38334 344. 00039 136 7452 13. 55 0. 97550 0. 97700 230. 72171 7. 46374 351. 46413 137 7611 13. 65 0. 98170 0. 97940 234. 13976 7. 59292 359. 05706 138 7735 13. 75 0. 98330 0. 98430 237. 58294 7. 74313 366. 80018 139 7907 13. 85 0. 99070 0. 99250 241. 05126 7. 92161 374. 72180 140 8119 13. 95 1. 00270 0. 99890 244. 54471 8. 08824 382. 81004 141 8190 14. 05 0. 99710 0. 99970 248. 06330 8. 21119 391. 02123 142 8298 14. 15 0. 99600 0. 99540 251. 60701 8. 29267 399. 31389 S8 nframe time (fs) count norm smooth 1 10 237 0. 095257 0. 095257 2 20 294 0. 118167 0. 118167 3 30 314 0. 126206 0. 126206 4 40 281 0. 112942 0. 112942 5 50 241 0. 096865 0. 080922 6 60 208 0. 083601 0. 062031 7 70 155 0. 062299 0. 047696 8 80 100 0. 040193 0. 036576 9 90 101 0. 040595 0. 034164 10 100 72 0. 028939 0. 028269 11 110 82 0. 032958 0. 024250 12 120 57 0. 02291 0. 017819 13 130 42 0. 016881 0. 015005 14 140 34 0. 013666 0. 013666 15 150 36 0. 014469 0. 012192 16 160 32 0. 012862 0. 009244 17 170 23 0. 009244 0. 007235 18 180 14 0. 005627 0. 006297 19 190 17 0. 006833 0. 006297 20 200 16 0. 006431 0. 006297 21 210 14 0. 005627 0. 004823 22 220 17 0. 006833 0. 004153 23 230 5 0. 00201 0. 002144 24 240 9 0. 003617 0. 002412 25 250 2 0. 000804 0. 001742 26 260 7 0. 002814 0. 001742 27 270 4 0. 001608 0. 000938 28 280 2 0. 000804 0. 000938 29 290 1 0. 000402 0. 000804 30 300 4 0. 001608 0. 000938 31 310 1 0. 000402 0. 000536 32 320 2 0. 000804 0
, and the IPBSL T eam (2014). Río Tinto: A geochemical and mineralogical terrestrial analogue of Mars. Life ( Basel) 4, 511–534. Andersson, A. F. , and Banfield, J. F. (2008). Virus population dynamics and acquired virus resistance in natural microbial communities. Science 320, 1047–1050. Angelov, A. , and Liebl, W. (2006). Insights into extreme thermoacidophily based on genome analysis of Picrophilus torridus and other thermoacidophilic archaea. J. Biotechnol. 126, 3–10. Baker, B. J. , Tyson, G. W. , Webb, R. I. , Flanagan, J. , Hugenholtz, P. , Allen, E. E. , and Banfield, J. F. (2006). Lineages of acidophilic archaea revealed by community genomic analysis. Science 314, 1933–1935. Batty, J. D. , and Rorke, G. V. (2006). Development and commercial demonstration of the Bio COP TM thermophile process. Hydrometallurgy 83, 83–89. Blowes, D. W. , Ptacek, C. J. , Jambor, J. L. , and Weisener, C. G. (2003). The Geochemistry of Acid Mine Drainage. In T reatise on Geochemistry, Volume 9, Holland, H. D. , and Turekian, K. K. , eds (Elsevier, Amsterdam, the Netherlands), pp. 149–204. Brierley, C. L. (2008). How will biomining be applied in future. T rans. Nonferrous Met. Soc. China 18, 1302–1310. Brierley, C. L. , and Brierley, J. A. (1973). A chemoautotrophic and thermophilic microorganism isolated from an acid hot spring. Can. J. Microbiol. 19, 183–188. Brierley, C. L. , and Brierley, J. A. (2013). Progress in bioleaching: part B: applications of microbial processes by the minerals industries. Appl. Microbiol. Biotechnol. 97, 7543–7552. Brierley, J. A. (1966). Contribution of Chemoautotrophic Bacteria to the Acid Thermal Waters of the Geyser Springs Group in Y ellowstone National Park. Ph. D. Thesis, Montana State University, Bozeman, MT , USA. Brierley, J. A. , Norris, P. R. , Kelly, D. P. , and Le Roux, N. W. (1978). Characteristics of a moderately thermophilic and acidophilic iron-oxidizing Thiobacillus. Eur. J. App. Microbiol. 5, 291–299. Brock, T. D. , Brock, K. M. , Belly, R. T. , and Weiss, R. L. (1972). Sulfolobus: a new genus of sulfur-oxidizing bacteria at low p H and high temperature. Arch. Microbiol. 84, 54–68. Cárdenas, J. P. , Valdés, J. , Quatrini, R. , Duarte, F. , and Holmes, D. S. (2010). Lessons from the genomes of extremely acidophilic bacteria and archaea with special emphasis on bioleaching microorganisms. Appl. Microbiol. Biot. 88, 605–620. Colmer, A. R. , and Hinkle, M. E. (1947). The role of microorganisms in acid mine drainage: a preliminary report. Science 106, 253–256. Coram, N. J. , and Rawlings, D. E. (2002). Molecular relationship between two groups of the genus Leptospirillum and the finding that Leptospirillum ferriphilum sp. nov. dominates South African commercial biooxidation tanks that operate at 40°C. Appl. Environ. Microbiol. 68, 838–845. Darland, G. , Brock, T. D. , Samsonoff, W. , and Conti, S. F. (1970). A thermophilic, acidophilic mycoplasma isolated from a coal refuse pile. Science 170, 1416–1418. Denef, V. J. , Mueller, R. S. , and Banfield, J. F. (2010). AMD biofilms: using model communities to study microbial Acidophile Microbiology in Space and Time \| 15 evolution and ecological complexity in nature. ISME J. 4, 599–610. Dold, B. (2010). Basic concepts in environmental geochemistry of sulfidic mine-waste management. In Waste Management, Sunil Kumar, E. , ed. (In T ech publishers, Rijeka, Croatia), pp. 173–198. Dold, B. , Gonzalez-T oril, E. , Aguilera, A. , Lopez-Pamo, E. , Cisternas, M. E. , Bucchi, F. , and Amils, R. (2013). Acid rock drainage and rock weathering in Antarctica: important sources for iron cycling in the Southern Ocean. Environ. Sci. T echnol. 47, 6129–6613. Edwards, K. J. , Goebel, B. M. , Rodgers, T. M. , Schrenk, M. O. , Gihring, T. M. , Cardona, M. M. , Hu, B. , Mc Guire, M. M. , Hamers, R. J. , Pace, N. R. , et al. (1999). Geomicrobiology of pyrite (Fe S2) dissolution: a case study at Iron Mountain, California. Geomicrobiol. J. 16, 165–179. Falagan, C. , Sanchez-Espana, J. , and Johnson, D. B. (2014). New insights into the biogeochemistry of extremely acidic environments revealed by a combined cultivation-based and culture-independent study of two stratified pit lakes. FEMS Microbiol. Ecol. 87, 231–243. Golovacheva, R. S. , and Karavaiko, G. I. (1979). Sulfobacillus – a new genus of spore-forming thermophilic bacteria. Microbiology (English translation of Mikrobiologiya) 48, 658–665. Goltsman, D. S. A. , Denef, V. J. , Singer, S. W. , Ver Berkmoes, N. C. , Lefsrud, M. , Mueller, R. S. , Dick, G. J. , Sun, C. L. , Wheeler, K. E. , Zemla, A. , et al. (2009). Community genomic and proteomic analyses of chemoautotrophic iron oxidizing “Leptospirillum rubarum” (group II) and “Leptospirillum ferrodiazotrophum” (group III) bacteria in acid mine drainage biofilms. Appl. Environ. Microbiol. 75, 4599–4615. Guay, R. , and Silver, M. (1974). Thiobacillus acidophilus sp. nov. : isolation and some physiological characteristics. Can. J. Microbiol. 21, 281–288. Hallberg, K. B. , González-T oril, E. , and Johnson, D. B. (2010). Acidithiobacillus ferrivorans sp. nov. ; facultatively anaerobic, psychrotolerant, iron- and sulfur-oxidizing acidophiles isolated from metal mine-impacted environments. Extremophiles 14, 9–19. Hallberg, K. B. , Hedrich, S. , and Johnson, D. B. (2011). Acidiferribacter thiooxydans, gen. nov. sp. nov. ; an acidophilic, thermo-tolerant, facultatively anaerobic iron- and sulfur-oxidizer of the family Ectothiorhodospiraceae. Extremophiles 15, 271–279. Harrison, A. P. Jr (1981). Acidiphilium cryptum gen. nov. , sp. nov. , heterotrophic bacterium from acidic mineral environments. Int. J. Sys. Bacteriol. 31, 327–332. Hold, C. , Andrews, B. A. , and Asenjo, J. A. (2009). A stoichiometric model of Acidithiobacillus ferrooxidans ATCC 23270 for metabolic flux analysis. Biotechnol. Bioeng. 102, 1448–1459. Johnson, D. B. (2007). Physiology and ecology of acidophilic microorganisms. In Physiology and Biochemistry of Extremophiles, Gerday, C. , and Glansdorff, N. , eds. (American Society of Microbiology Press, Washington, DC, USA), pp. 257–270. Johnson, D. B. (2012). Geomicrobiology of extremely acidic subsurface environments. FEMS Microbiol. Ecol. 81, 2–12. Johnson, D. B. (2014). Biomining – biotechnologies for extracting and recovering metals from ores and waste materials. Curr. Opin. Biotechnol. 30, 24–31. Johnson, D. B
Morrison and Johnstone (430) have calculated theo- reticd ratios of k,/k Ka Cl from electrostatic and internal pressure theories, where k, represents the salting-out constant of HC1, Li C1, KC1, KHIC1, 1/2Ba C12, KMe4C1, NEt4C1, Na Br, Ka I, Na K03, or 1/2Na2S04. The in- ternal preasure results accord better with the observed order of ratios than the electrostatic approach but does not fit the NMe4Cl and NEt4C1 salt ratios for the more "inert" gases. The kz/k Na C1 ratio is linear for a series of solute gases in a given salt solution except the salts Ka I, NMe4C1, and NEt4C1. With these salts a specific effect is observed. When a correction for the van der Waals forces between ions and neutral molecules is applied the k,/k Na C1 ratios become linear for these salts. The salt effect constant, k,, can be referred to either unit volume of electrolyte solution or the unit weight of solvent. Morrison points out that the weight basis is more closely related to the theoretically significant mole fraction and reports his results on a solvent weight (molality) basis. On this basis nitric acid and tetra- alkylammonium halides salt in He, We, n-Cr Hlo, and benzene vapor but salt out SF6. The salting out of 02, Ar, Xe, CHr, and C2He by Li C1, Na C1, KC1, and Mg Clz (173), Cz H6 by Na Cl and Ca Cl2 (123), and C2Hz by numerous halide, nitrate, and sulfate salts (188) has been explained by hydration theories. Eucken and Hertzberg (173) have derived an expression for the hydration number of an ion based on an equilib- rium association of water molecule clusters of one to eight molecules, the displacement of the equilibrium by the ions, and the competition of the ions and dis- solved gas molecules for water of hydration. They get ion hydration numbers around 10. Flid and Golynets (188) point out that salting out increases in the order the cations increase in ease of hydration between 0 and 25", but that the order differs in the 50-70" range. In general, as pointed out by Mc Devit and Long, the hydration numbers got ten by gas solubility measure- ments do not correspond with degrees of hydration ob- tained from other experiments. Namiot (439) discusses aqueous gas solubilities in terms of a two-structure model of water. The dis- solved gas molecules transform some "liquid" water molecules to "icelike" molecules. An equation is given for calculating the number of water molecules bonded to one gas molecule and the number of dis- placed water molecules. The Setschenow constant, k', is related to the number of bonded water molecules. Clever and Reddy (99) have obtained salting-out constants for helium and argon by Na I in both methanol and water. The ratio is less than expected from the dielectric constant difference of the solvents. The van der Waals approach of Bockris, Bowler-Reed, and Kitchener (53) was not sufficiently sensitive to explain the ks~e O&,~n O ratio for either gas. Many studies have been made on the effect of aqueous electrolyte solutions on the activity coefficients of dissolved hydrocarbon gases. With one exception the studies of Table 111 were carried out in aqueous solution. Salting out is the general rule. Exceptions include Na dodecyl sulfate and K oleate, where micelle formation and increased interaction energy between the hydrocarbon gas and the hydrocarbon-like micelle interior may explain the enhanced solubility over that in pure water. Guanidine hydrochloride, nitric acid, and tetralkylammonium halides salt in hydrocarbons. The increased solubility of ethylene in silver nitrate solutions is certainly due to formation of the Agf. C2H4 complex ion. It is suggested (387) that the increased solubility of acetylene in acetone in the presence of Na I is because acetylene is more soluble in an acetone. Na1 418 RUBIK BATTINO AND H. LAWRENCE CLEVER TABLE I11 SALT EFFECTS ON HYDROCARBON GASES Ethyl acetylene Benzene vapor, C4H10 Salts Na C1, Ca C12, Mg Cl. Na Cl Ba C1, Li C1, KI Alkali halides Guanidine hydrochloride Na C1, Ca C12 Xa dodecyl sulfate Na Cl "Neutral salts" Na Cl "Neutral salts" K oleate Na C1 "Keutral Salts" Xa I (in acetone and di- methylformamide) Na C1, Na OH HN03, tetralkyl am- monium halides KC1, Ag N03 Ref 422 153 428 173 640 123 660 621 268 364 260 403 402 303 188 387 571 430 complex than in pure acetone. Na I has little effect on acetylene solubility in dimethylforniamide. The Setschenow equation does not apply to iso- butylene solubilities in aqueous Na Cl at temperatures near 0" (303). The interest in oceanography has resulted in studies of nitrogen, oxygen, and noble gas solubilities in sea water and saline solutions (41, 42, 153, 327, 611). These systems salt out. Green (231) has made a careful study of oxygen solubility and Douglas (152) has determined nitrogen and argon solubility as a function of chlorinity (halide as g of chlorine/kg of sea water) and temperature. Green shows the oxygen solubility obeys a Setschenow-like equation with chlo- rinity used in place of salt molality. The solubility of a gas over the range of 0 to 100% aqueous strong acid has been studied. The solubility of COz initially decreases (salts out), goes through a minimum, increases to a maximum at a composition corresponding to Hz S04. 4Hz0, goes through a second minimum at a composition of Hz S04. Hz0, then in- creases until pure Hz S04 is reached (392, 555, 556). The minimums become less pronounced as the tem- perature increases (5X5). Naz S04 in aqueous Hz S04 solutions of various composition salts out (556). COZ is salted in as the concentration of HC104 increases from 0 to 50 wt. yo; it is salted out from 50 to 70 wt. % (392). The solubility of chlorine in aqueous 0 to 50 wt. %; HC104 decreases sharply up to 5 M and then stays constant to higher HCl O4 concentrations (551). Oxygen solubility decreases to a minimum at about 80% Hz S04 and then increases sharply as 100% H2S04 is approached. Oxygen solubility decreases steadily as H3P04 concentration increases (235). Solubilities of oxygen in various nitric acid (502) and in white and red fuming nitric acid (579) are reported. CIOz solubilities in aqueous Hz S04 and aqueous acetic acid obey Henry's law (305). The neutral nature of PH3 has been deduced from its similar solubility in aqueous Na OH, Na C1, and Hz S04 (639). The solubility of KZ in buffered solutions of various transition metal acetates indicated no unusual association of Nz and transition ion (70). Chlorine is salted out by Ba CL (51), LEI, Sr Clz and Ba Clz (292), and Li Cl Ok and Na C104 (291) in aqueous solution between 10 and 50". The temperature dependence of the salting-out constant, k,, is small and negative at least in aqueous solutions at atmospheric pressure and temperatures below 70". This is true of Nz O and COZ in several chlo- rides, nitrates, and sulfates between 0 and 40" (391), Clz between 10 and 50" (51, 291, 292), and COz in sulfuric acid between 20 and 60" (555). The salting out of acetylene is more pronounced between 0 and 25" than at higher temperatures up to 70" for 23 salts. The acetylene solubility goes through a minimum between 25 and 70" with the minimum becoming weaker at higher concentrations of the salt; no mini- mum is observed for Na C1, Zn Clz, Zn SO4, Mg S04, SS04, Ca S04, and Alz(S04)3 (188). Sulfur dioxide is salted out at low temperatures but salts in with Na HS03 at 90" (348). Long and Mc Devit (373) differentiate with respect to temperature their internal pressure expression for k, Eq 37, to get where Vi" and P," are, respectively, the partial molar volumes of nonelectrolyte and of electrolyte at infinite dilution. The relation predicts dk,/d T to be small and negative, to be smaller in the 25-50" range than the 0-25" range, and that dk,/d T will be small for Li Cl and relatively large for KNO3 with salts such as Na C1, KCI, KBr, KI, Wa OH, and 1/z Naz S04 being intermediate in value. The predictions agreed well with the salt effect data of Alarkhani and Kobe (391) on Nz O and COz when reasonable partial molal volumes of the gases were used. Morrison (426) gets approximate values for the difference in the heat capacity of solution between water and salt solution from the temperature dependence of gas solubility in water and in salt solution
Also, it is were taken (sampled cell,type of waste mainly buried in place, age known that acid or alkaline solutions are used in practice to solu- of waste, etc. ) to assess how waste composition of a landfill site bilise REEs, PGMs and other metals from minerals due to their very affects critical metal content and better understand the major high or low p H values (Xie et al. , 2014; Crundwell, 2014a,b). The source of these metals. fact that no direct relationship between depth and concentration Other studies where critical metal analysis was carried out in of critical metals was found could imply that leachate (which pre- waste samples from landfill sites could not be found. However sents neutral p H of around 7 units) is not vertically mobilising Morf et al. (2013) analysed the presence of some REEs, PGMs and these metals through the landfill and that metals are being other metals in Ms W used as fuel in an incinerator in retained between soil layers. Switzerland. Furthermore, James (2011) assessed the quantity of Furthermore, measurements of the TS and VS were carried out REEs and PGMs in landfill leachate and its sediment. Fig. 2 shows to establish a general composition of the samples and to assess the concentrations of selected metals (REEs, PGMs and precious whether there is a correlation between metal content and volatile metals) found in the previous mentioned studies and compare solids. Results from each LFS were similar between each other and them against the total average values obtained from the four UK have no major variations. Average TS content in each LFS was landfill sites. 58 ±7% for Site A, 79 ±9% for Site B, 63 ±6% for Site C and Concentrations of Sc, Y, Pr, Nd and Gd were consistent across 66 ± 9% for site (Fig. 4). From all samples, the TS content was above MSW and landfilled material (Fig. 2). Values ranged between 1 44% and below 99% resulting in average moisture content of and 3 mg kg-1 and could imply that these metals are not lost 36 ± 10%. Results are within the range of what has been reported within the reactions of the landfill (e. g. mobilised by leachate) in the literature; studies where waste extracted from several land- (Gould et al. , 1990). However, even though no significant concen- fills was analysed for possible material recovery had in average trations were found in landfill leachate for REEs and PGMs between 50% and 84% TS content (Kaartinen et al. , 2013a,b; (James, 2011), the sediment of the leachate showed presence of Prechthai et al. , 2008). Please cite this article in press as: Gutiérrez-Gutiérrez, S. C. , et al. Rare earth elements and critical metal content of extracted landfilled material and potential recovery opportunities. Waste Management (2015), [URL] ARTICLE IN PRESS S. C. Gutierrez-Gutierrezet al. /Waste Managementxx(2015) xxx-xxx Msw Landfil Leachate Leachate sediment Ce Pr Nd Gd Fig. 2. Average concentration of selected metals present in Ms W (Morf et al. , 2013), landfll, landfill leachate and sediment of landfill leachate (James, 2011). Landfill category referstovaluesobtained inthiswork. Sc Y 20. 10 20 10 20 Depth(m) Depth (m) La Ce 50 3 50 40 80 :11. 20 10 10 20 80 10 20 Depth (m) Depth (m) Nd Li 10 20 30 10 20 30 Depth (m) Depth(m) Co Sb 4 10 20 30 10 20 30 Depth(m) Depth (m) Please cite this article in press as: Gutierrez-Gutierrez, S. C. , et al. Rare earth elements and critical metal content of extracted landfilled material and potential recovery opportunities. Waste Management (2015), [URL] ARTICLE IN PRESS S. C. Gutierrez-Gutierrez et al. /Waste Management xx (2015) xxx-xxx 120 assumed that the revenues from LFM the four studied landfills are not enough to be economically viable. 100 Other metals such as Cu, Al, Ag, Au, Ni and Zn could be used to increase and supplement the economic value of LFM counteracting the losses of extracting single critical metals. With regards to the key challenges in metal recovery the metal o content depends mostly on waste composition which varies between landfills and could make difficult to ensure a typical con- S 40 centration of critical metals for landfills. Nonetheless, Krook et al. 20 (2012) found some patterns in the composition of landfilled waste; 50-60% weight of soil-type material, 20-30% weight combustibles, 0 10% weight inorganic materials and less weight percent for metals Site A Site B Site C Site D (Krook et al. , 2012), which help to identify patterns in metal Fig. 4. Total solids content of the landilled material from each landfill site. content. Also, as shown in Table 2, major differences in metal concentrations between landfills were found for the metals not considered as critical which are more frequently used and at VS content resulted in 41 ± 9%, 25 ± 10%, 32 ± 11% and 34 ± 12% different quantities. for Site A, Site B, Site C and Site D, respectively. Metals concentra- Another concern is in proving that the recovery of these metals tions and vs content were compared to assess the existence of a from a landfill site is economically viable. As stated previously, due relationship between each other. The correlation coefficients to the low concentrations of critical metals the only way to make (R ≤ 0. 20) observed indicates that the concentration of metals is LFM economically viable is to target more materials to recover, unaffected by the content of Vs content. An increase in the VS specifically refuse-derived fuels (RDF) for energy recovery and content does not increase or decrease the metal content in the materials as part of an ELFM approach. It has been previously sug- landfilled material and there is not a specific percentage range of gested that the only materials from a landfill which can provide VS that presents higher concentrations the critical metals. enough profits are the ones that can be used as supplementary Even though the results could not demonstrate that higher VS waste fuel due to the clear market for energy (Krook et al. , 2012; content results in an increase in the concentration of critical metals Van Passel et al. , 2013; Chapman et al. , 2010, 2011). The use of within the landfilled material, this does not mean that the organic RDF sourced from landfilled materials in advanced thermal conver- matter does not affect the retention of these metals in the landfill. sion processes has been investigated (Bosmans et al. , 2014), high- VS content analysis takes into account plastics, paper and other lighting the attractive potential for upcycling excavated materials materials that are within the sample and so it cannot be assumed as an alternative to conventional energy recovery. Therefore, the that all VS account for the organic compounds that can retain met- recovery of this material for energy recovery and/or upcycling als. Organic matter and microbial ecology are very important in the together with critical metals would increase the economic benefits absorption and mobilisation of metals (Bradl et al. , 2005; Bozkurt and viability of the project. et al. , 1999) and so further work on microbial activity is required. Van Passel et al. (2013) states that a substantial economic potential exists for landfill mining projects and describes several economic methodologies for exploring the economic potential of 3. 3. Opportunities for metal recovery landfill mining (Van Passel et al. , 2013), including private and social costs and benefits, where the inclusion of recovered critical The total amount of metals that could be recovered from the metals definitely increases the profits. Furthermore, the technol- four landfills was calculated using the quantity of wastes buried ogy performance (efficiency) is an uncertainty that keeps the (or disposed of) in each LFs. Reviewing the market price of the companies out of these projects (Krook et al. , 2012). Recovered obtained metals an estimated value by assuming a high degree of landfilled waste must pass through a screening process to obtain purity (>99%) was then calculated (Table 3). The most valuable the soil-type fraction where the critical metals are extracted. metals are the commonly known precious metals including Pt, Therefore, technologies for excavation and materials processing Au, Pd and Ru. Despite only 5 tonnes of PGMs estimated from are required to extract and segregate the waste from the landfill the four landfills sites there is a good opportunity of significant site efficiently in order to obtain a relatively clean sub-product revenue of $148,246,000. For the REEs, Nd would present the high- (soil-type fraction) and marketable materials (recyclables). est value with $9,183,000 followed by Dy, Eu, Pr and Y, while for Technologies including wind shifters and magnet separation have the other critical metals; Li would generate more revenue with not been proven to be very efficient for separating the waste from $13,722,000 and Co having a value of $3,370,000. the soil-type in good quality sub-products
The current disruption must be extended to re- gions further down the tail in the case of longer lasting activity. Such tailward expanding disruption or reduction of the current has indeed been observed. In view of the speculative nature of the various substorrm scenarios, it might seem surprising that in situ measurements have contributed so little to clarify the situation. Remember here that the magnetosphere is a huge volume of space, the various regions of which have only been surveyed spo- radically by individual satellites on a point-by-point basis. The probability that a given satellite would be fortuitously located at the right place at the right time is thus relatively low. Furthermore, since measurements from a single satellite cannot discriminate between spatial and temporal variations, they are severely limited in their capability to investigate dynamical phenom- ena such as substorms. In response to this dilemma, more recent endeavors (like, for example, the CLUs TER mission) aim to resolve this ambiguity with the help of a feet of spatially separated satellites fying in formation. 8. 4 Thermospheric Storms A significant part of the solar wind energy absorbed during a geospheric storm is dissipated by electric currents and particle precipitation in the polar upper atmosphere. The resultant heating can be so intense that it produces not only local, but even global disturbances of the thermosphere. Following our previous naming convention, we denote such an event as a thermospheric storm. Due to the observed high wind velocities, this designation does comc close to our concept of a storm, but then all other state parameters such as temperature, mass density and composition are affected as well. Of the 8. 4Thermospheric Storms 423 many phenomena associated with a thermospheric storm, we address two specific aspects here, composition disturbances at mid-latitudes and density disturbances at equatorial latitudes. These two very striking effects are also intimately connected with ionospheric perturbations. 8. 4. 1 Composition Disturbances at Mid-latitudes The type of composition perturbation occurring during a thermospheric storm is, in principle, the same as that observed at polar latitudes during less disturbed conditions: heavier gases display an increase in density, lighter gases a decrease. These density changes are considerably stronger during a storm, however, and also not confined to the polar heating zone. This ex- pansion effect is shown schematically in Fig. 8. 14. A satellite with a neutral gas analyzer aboard, moving northward along the indicated polar orbit, for example, would enter the zone of disturbed neutral gas composition already at mid-latitudes. This is documented with actual data in Fig. 8. 15, where rel- ative changes in density are shown as a function of magnetic latitude (lower panel). The plotted curves, R(n), are the density values measured along the satellite trajectory during the storm, divided by the density values obtained during an undisturbed orbit. R(n) = 1 thus means no change with respect to quiet conditions and R(n) = 10 indicates a tenfold increase in density. The magnetic activity during the storm and reference orbits, as reflected by the Kp index, is plotted in the upper panel. The measurements clearly show that substantial density disturbances can occur at an altitude of 280 km. The rise in the argon density reaches a factor of 80 and that of molecular nitrogen a Energyinput N Zonesofdisturbed neutral gas composition S Energyinput Fig. 8. 14. Energy injection and formation of two zones of disturbed neutral gas composition during a thermospheric storm 424 8. Geospheric Storms October 1973 26 27 28 29 Storm Reference Kp orbit 8 orbit 6 () 4 2 0 280 km 100 Ar R 10 N2 0 0. 1 He 0 20 40 60 80 Magnetic latitude Fig. 8. 15. Latitudinal dependence of relative density changes as observed during a thermospheric storm. The form of the data presentation is described in the text. The density measurements refer to an altitude of 280 km and 9 hours local time. factor of 10. At the same time, the atomic oxygen density drops to nearly one half, the helium density to even one tenth, of the respective quiet-time values. Also remarkable is that the zone of disturbed composition extends down to a latitude of 30°. While the reasons for the observed density perturbations were already elucidated in Section 7. 5. 3, their extension down to mid-latitudes is still in need of an explanation. One assumes today that the density disturbances do indeed originate at polar latitudes, but are subsequently carried to mid- latitudes by strong winds. The details of this perturbation transport are still the subject of intensive investigation. It is well established, however, that the propagation occurs in the night sector and this is immediately understand- able. The ion drift in the polar caps leads to a strong acceleration of the airmass toward the night sector (see Fig. 7. 3 and Section 7. 5. 1). Moreover, two additional high pressure areas form in the polar heating zones during a storm, inducing winds which are superposed onto the normal diurnal wind circulation; see Fig. 8. 16. In the night sector, this amplifies the already es- 8. 4 Thermospheric Storms 425 Polar high pressure zone Dayside winds Convective disturbance Solarwind transport energy source Solarradiation Equatorial high pressure energysource zone Fig. 8. 16. Storm induced changes in the large-scale wind circulation and convective transport of composition perturbations to mid-latitudes tablished equatorward atmospheric circulation, generating storm winds with velocities of 1000-2000 km/h. These are the storm winds held responsible for the transport of the composition perturbations to mid-latitudes, whereby particular significance is attributed to the somewhat slower winds in the lower thermosphere. At lower heights, because of the much larger diffusion time constants there, composition perturbations persist much longer than in the upper thermosphere (compare with Section 2. 3. 6). In contrast to the night sector, perturbation transport on the dayside is prevented by the predominantly poleward directed winds. Even if the polar high pressure is strong enough to reverse the direction of the nominally pole- ward fowing airmass (as implied in Fig. 8. 16), the velocity of the resultant fow is simply too slow to produce significant expansion of the perturbation. The question then arises of why the composition disturbances are also ob- served on the dayside (the data of Fig. 8. 15, for example, apply to 9 hours local time). A plausible explanation is that, since the mid-latitude thermo- sphere essentially rotates with the Earth, any disturbance produced in the night sector will eventually be carried into the dayside by the corotation. 8. 4. 2 Density Disturbances at Low Latitudes The density perturbations observed during magnetic activity are not re- stricted to high and mid-latitudes. They also extend all the way down to equatorial regions, where they, however, assume a different form. This is doc umented in Fig. 8. 17, again using satellite data. These show the temporal changes in the argon, molecular nitrogen, atomic oxygen and helium den- sities, measured during a magnetic storm, at 290 km altitude for latitudes between 5 and 10°S. In response to the magnetic activity shown in the upper 426 8. Geospheric Storms panel, a fuctuating, but systematic, rise in the density is observed for all the gases. Evidently, other disturbance mechanisms are active here than at higher latitudes. Whereas the larger density increase of the heavier gases indicates a rise in the temperature, the density enhancement of the lighter gases can be more easily explained as a compression effect. The temperature increase of T。 < 160 K consistent with the nitrogen measurements, for example, would produce only a four percent increase in the helium density. Regardless of the immediate cause of the density increase, it is worth asking just why the observed disturbances can happen so fast and so far re- moved from the polar heating zone. Indeed, the first sign of a density increase 19 January 20January1973 1000 AE E 500 0 290km Ar 3 2 1 N2 2 0 2 He 2 2 6 12 18 24 18 24 Universaltime Fig. 8. 17. Thermospheric storm effects at low latitudes. The upper panel shows the development of polar magnetic activity during a two-day interval. The response of the upper atmosphere to this activity at low latitudes (5°- 10°S) is displayed in the lower panels, again with plots of the relative density changes. The reference density values were measured on the day before the magnetic storm. All densities refer to an altitude of 290 km and a local time of 01:00 hours (adapted from Prolss, 1997; for simplicity we mention here that Figs. 8. 18 and 8. 19 were also taken from this source and Figs. 8. 20 - 8. 22 are from Prolss, 1995). 8. 4Thermospheric Storms 427 is observed less than four hours after the beginning of the magnetic activity. One possible explanation is that the density increase is produced by a so- called traveling atmospheric disturbance (TAD). This is understood to be an impulse-like disturbance arising from a superposition of atmospheric gravity waves that propagates at high velocity (500 - 1000 m/s) from polar to equa- torial regions. Figure 8. 18 illustrates the essential features of this disturbance scenario. During a substorm - here indicated by an increase in the AL index - the polar upper atmosphere is subjected to a sudden injection of energy and heat- ing. The resulting expansion of the gases leads to excitation of a broad spec- trum of atmospheric gravity waves that propagate outward from their source region over the entire Earth. When these arrive at mid-latitudes, the higher frequency waves are already strongly damped and the low-frequency (long wavelength) components juxtapose to form an impulse-like disturbance that propagates equatorward at high velocity
LETTERS TO NATURE It has long been thought that the cool Ha surges could not be Prediction of ligand-promoted. explained by magnetic reconnection because reconnection would dissolution rates from heat any cool plasma to X-ray temperatures. Consequently, it has generally been argued that surges require separate mechan. the reactivitiesd ism which accelerates the plasma without heating it at the same time. Our simulations now provide a possible physical picture of aqueous complexes. of how magnetic reconnection can accelerate cool plasma (Ha surges) without much heating it. Our simulations also explain the coexistence of X-ray jets with Ha surges observed in some Christian Ludwig, william H. Casey+ cases (ref. 1 and R. C. Canfield et al. , manuscript in prepara- & Peter A. Rock. tion). Note also that our simulation has predicted a spatial offset of the Ha and X-ray jets, recently observed by Canfield et al. * Department of Land, Air and Water Resources, t Department of. (manuscript in preparation). The cool magnetic island that is Geology, Department of Chemistry, University of California, Davis, ejected horizontally in the horizontal-field case has not yet been California 95616, USA observed, probably because of difficulties in resolving such fine structure. It will be interesting to search in future observations EARTh scientists have long recognized'- that the soluble organic. with high spatial resolution for ejection of this cool island. acids excreted by soil biota enhance rates of mineral weathering, Recently, Shimizu et al. '' discovered many transient brighten thereby chemically stratifying the soil and affecting the biodegrad- ings in active regions with the Yohkoh. o soft X-ray telescope2' ation pathways of organic matter, including pollutants. Multident- These transient brightenings correspond to spatially resolved ate organic ligands6,7 also exist in industrial waste waters and. microflares which have been often thought to be one of main can enhance the mobility of heavy elements, including mechanisms of the coronal heating'. Although the origin of these radionuclides'. Here we examine whether rate coefficients for lig- transient brightenings is still a puzzle, there is a possibility that and-promoted disolution of minerals can be predicted from existing they are the result of reconnections similar to those discussed studies of dissolved metal complexes. We have performed dissolu- above. The horizontal jets of the two-sided-loop case are not tion experiments on bunsenite (Ni O) to compare with published necessarily observed as jets, and instead they are more likely to studies of ligand exchange around dissolved Ni(n)-ligand be observed as transient loop brightenings if the horizontal field complexes1o-12. The hypothesis is confirmed with surprising detail:. is a part of a coronal loop. Thus, our results may suggest that. the dissolution rate coefficient increases with the number of ligand the jets and the loop brightenings are not physically independent functional groups coordinated to the surface metal, as do the but closely related. In relation to the coronal heating, it has been Sutcloselyrelated. Tmrelatonto thecoronlalneating,llnasbeen exchange rate coefficients10-12. Furthermore, we find that the disso- found that observed microflares do not possess enough energy lution rate coefficients can be predicted from the equilibrium con- to account for the coronal heating'2. But the common physical stants for metal complexation in solution, indicating that the origin of jets and loop brightenings strongly suggests the pos- activated surface complexes resemble the corresponding dissolved sibility of association of these two features, and hence that the complexes in important ways. relevant volume and the total energy of the jets and loop bright- Furrer and Stumm'' established a framework for treating the enings may be larger than those inferred from observations of dissolution of oxide minerals by showing that rates are propor- loop brightenings. This suggests also that the estimate of the tional to the concentration of adsorbed protons and surface total energy in each loop brightening might be an underestimate metal-ligand complexes. These adsorbates enhance the reactivity The numerical simulations presented here should help the of the mineral surface and, to a suitable level of accuracy, pro understanding of the physical relation between jets (both X-ray ton- and ligand-promoted pathways can be treated as indepen- and Ha), loop brightenings and coronal heating, and further suggests the importance of magnetic reconnection23. 24 in solar. dent. For p H Iess than the point of zero charge, and with only a single rate-enhancing ligand complex at the surface, a suitable coronal activity. rate law is13: Rate (mol m-2 s~')=k+[>XOH{]"+kt[>XL] (1) Received 2 November 1994; accepted 14 March 1995. 1. Shibata. K. et al. Pub/s astr. Soc. Jap. 44L173-L179 1992 where k+ and k, are the rate coefficients for dissolution via the 2. Shibata,K. , Yokoyama,T. & Shimojo M. in Proc. Kofu Symp. New Look at the Sun with proton-promoted and ligand-promoted pathways, respectively Emphasis on Advanced Observations of Corona/ Dynamics and Flares (eds Enome, S. & Hirayama,T. ) 75-78 Nobeyama Radio Obs. , Nobeyama,1994. The variables (I>XOH) and (>XL) are concentrations of the 3. Shimojo M. et al. Publs astr. Soc. Jap. submitted surface complexes and n is a rate order. The structure of metal- 4. Strong, K. T. et ai. Publs astr. Soc. Jap. 44, L161-L166 (1992). 5. Parker,E. N. Astrophys. J. 330474-4791988 ligand surface complexes is important. Organic ligands that form 6. Kurokawa, H. & Kawai, G. in The Magnetic and Velocity Fields of Solar Active Regions (eds bidentate rings are more effective than monodentate ligands in Zirin, H. , Ai, G. & Wang, H. ) 507 (Conf. Ser. 46; Am. Soc. Phys. , San Francisco, 1993). 7. Rust, D. M. , Webb, D. F. , & Mac Combie, W. Solar Phys. 54, 53-56(1977 promoting dissolution, and smaller (five- and six-membered) 8. Shibata, K. , Nozawa, S. & Matsumoto, R. Publs astr. Soc. Jap. 44, 265-272 (1992) bidentate rings are much more effective in enhancing rates than 9. Yokoyama, T. & Shibata, K. in Proc. Kofu Symp. New Look at the Sun with Emphasis on larger rings13,14. Advanced Observations of Coronat Dynamics and Flares (eds Enome, S. & Hirayama, T. ) 367-370Nobeyama Radio Obs. ,Nobeyama,1994). We can extend these results to yield information about surface 10. Zirin, H. Astrophysics of the Sun 316-322 (Cambridge Univ. Press, 1988). reaction mechanisms if there is close correspondence between 11. Shibata, K. et al. in Proc. X-ray Solar Physics from Yonkoh (eds Uchida, Y. , Watanabe, T. Shibata, K. & Hudson, H. S. ) 29-32 (Univ. Academy, Tokyo. 1994). the ligand-exchange reaction in solution and metal removal from 12. Shibata, K. et al. Astrophys. J. 345, 584-596 (1989) a dissolving surface. One observation10-12 from ''O-NMR is that 13. Nozawa, S. et al. Astrophys. J. Suppi. Ser. 78, 267-282 (1992). the reactivity of bonds between metals and hydration water 14. Matsumoto, R. et al. Astrophys. J. 356, 259--271 (1990). 15. Sato,T. &Hayashi,T. Phys. Fluids 221189-12021979. molecules increases with the number of certain other ligands in 16. Ugai, M. Plasma Phys. Controlled Fusion 27,1183-1194 (1985) the inner coordination sphere (Fig. la). Carboxylates, amines 17. Yokoyama, T. & Shibata, K. Astrophys. J. 436, L197-L200 (1994), 18. Shibata,K. et al. Astrophys. J. 431. L51-L531994 and some inorganic ligands enhance the rates of water exchange 19. Shimizu, T. et al. Pub/s astr. Soc. Jap. 44, L147-L153 (1992). by reducing the metal charge and weakening bonds to distal 20. Ogawara, Y. et al. Pub/s. Astr. Soc. Jap. 44, L41-L44 (1992). 21. Tsuneta,S. et al. Solar Phys. 136,37-671991) oxygens's. When translated to a dissolving mineral, the observa- 22. Hudson, $. H. Solar Phys. 133, 357-369 (1991). tion suggests that rate coefficients for dissolution increase pre-. 23. Heyvaerts, J. , Priest, E. R. & Rust, D. M. Astrophys. J. 216,123-137 (1977 24. Rust,D
, 1997, ‘‘Petrography and depositional environment of the U-mineralized phosphatic siliceous dolostone of Vempalle formation, Cuddapah basin. ’’ Journal of Geological Society, India , 50, pp. 577–585. Sand, W. , Gerke, T. , Hallmann, R. , and Shippers, A. , 1995, ‘‘Sulfur chemistry, bioﬁlm and the (in)direct attack mechanisms- a crucial evaluation of bacterial leaching. ’’ Applied Micro- biology and Biotechnology , 43, pp. 961–966. Sand, W. , Gehrke, T. , Hallmann, R. , and Schippers, A. , 1998, ‘‘Towards a Novel Bioleaching Mechanism. ’’ Mineral Processing and Extractive Metallurgy Review , 19, pp. 97–106. Sand, W. , Tilman, G. , Peter-Georg, J. , and Schippers, A. , 2001, ‘‘(Bio)-chemistry of bacterial leaching-direct vs. indirect bioleaching. ’’ Hydrometallurgy , 59(2–3), pp. 159–175. Sankaran, R. N. , Sah, V. N. , Singh, T. P. , and Dwivedy, K. K. , 1998, ‘‘Heap leaching on ura- nium ores at Baginda, Himachal Pradesh. A case study of effective pollution control. ’’ Exploration and Research of Atomic Minerals , 1, 165–167. Saraswat, A. C. , 1988, ‘‘Uranium mineralization in the Indian perspective and strategy. Explo- ration and research for atomic minerals. ’’ AMD, India , 1, pp. 1–11. Schnell, H. A. , 1997, Bioleaching of Copper, In Biomining: Theory, Microbes and Industrial Processes , (D. E. Rawlings, Eds. ), Berlin: Springer-Verlag, pp. 21–43. Seeger, M. and Jerez, C. A. , 1993, ‘‘Response of Thiobacillus ferrooxidans to phosphate limi- tation. ’’ FEMS Microbiology Review , 11(1–3), pp. 37–41. Shakir, K. , Aziz, M. , and Beheir, Sh. G. , 1992, ‘‘Studies on uranium recovery from uranium-bearing phosphatic sandstone by a combined heap leaching -liquid-gel extrac- tion process. 1- Heap leaching. ’’ Hydrometallurgy , 31, pp. 29–40. Shoep, A. , 1923, ‘‘A new radioactive mineral, Parsonite. ’’ Journal of the Franklin Institute , 195(4), p. 584. Shrihari, J. , Modak, M. , Kumar, R. , and Gandhi, K. S. , 1995, ‘‘Dissolution of particles of pyrite mineral by direct attachment of Thiobacillus ferrooxidans. ’’Hydrometallurgy , 38, pp. 175–178. 112 ABHILASH AND B. D. PANDEY Downloaded by [Mc Gill University Library] at 04:56 07 November 2012 Strasser, H. , Burgstaller, W. , and Schinner, F. , 1994, ‘‘High yield production of oxalic acid for metal leaching processes by Aspergillus niger. ’’FEMSMicrobiology Letters ,1 1 9 ,p p. 3 6 5 – 3 7 0. Sugio, T. , Domatsu, C. , Munakata, O. , Tano, T. , and Imai, K. , 1985, ‘‘Role of ferric ion-reducing system in sulfur oxidation of Thiobacillus ferrooxidans. ’’ Applied and Environmental Microbiology , 49, pp. 1401–1406. Sugio, T. , Katagiri, T. , Moriyama, M. , Inagaki, K. , and Tano, T. , 1988b, ‘‘Existence of a new type of sulphite oxidase which utilizes ferric iron as an electron acceptor in Thiobacillus ferrooxidans. ’’Applied and Environmental Microbiology , 54, pp. 153–157. Sugio, T. , Wada, K. , Mori, M. , Inagaki, K. , and Tano, T. , 1988a, ‘‘Synthesis of an iron oxidiz- ing system during the growth of Thiobacillus ferrooxidans on sulfur basal salts medium. ’’ Applied and Environmental Microbiology , 54, pp. 150–152. Sugio, T. , White, K. J. , Shute, E. , Choate, D. , and Blake, R. C. , 1992, ‘‘Existence of a hydro- gen sulﬁde ferric ion oxidoreductase in iron oxidizing bacteria. ’’ Applied and Environmen- tal Microbiology , 58, pp. 431–433. Taylor, G. , Farrington, V. , Woods, P. , and Molloy, R. , 2004, ‘‘Review of Environmental Impacts of the Acid In situ Leach Uranium Mining Process. ’’ CSIRO Land and Water Client Report August 2004. Available on line at: www. epa. sa. gov. au/pdfs/isl_review. pdf Torma, A. E. , 1983, ‘‘Biotechnology applied to mining of metals. ’’ Biotechnology Advances , 1(1), pp. 73–80. Torma, A. E. and Banhegyi, I. G. , 1984, ‘‘Biotechnology in hydrometallurgical processes. ’’ Trends in Biotechnology , 2, pp. 13–15. Tuovinen, O. H. , 1984, ‘‘Effect of p H, iron concentration and pulp densities on the solubilisation of uranium from ore materials chemicals and microbiological acid solutions: regressionequation and conﬁdence band analysis. ’’ Hydrometallurgy , 12, pp. 141–149. Waksman, S. A. and Joffe, I. S. , 1992, ‘‘Microorganisms concerned with the oxidation of sul- fur in soil. II Thiobacillus thiooxidans, a new sulfur oxidizing organisms isolated from the soil. ’’ Journal of Bacteriology , 7, pp. 239–256. Williams, H. , Colman-Sadd, S. P. , and Swinden, H. S. , 1988, ‘‘Tectonic-stratigraphic subdivi- sions of central Newfoundland. ’’ Geological Survey of Canada , 91–98. MICROBIALLY ASSISTED LEACHING OF URANIUM —A REVIEW 113 Downloaded by [Mc Gill University Library] at 04:56 07 November 2012
Each metric depends on a generated set Gand a test (reference) set R. We compute all metrics (except for validity) only for valid molecules from the generated set. We suggest generating 30;000molecules and obtaining Gas valid molecules from this set. Fraction of valid (Valid) and unique (Unique@k) molecules report validity and uniqueness of the generated SMILES strings. We deﬁne validity using RDKit’s molecular structure parser that checks atoms’ valency and consistency of bonds in aromatic rings. In the experiments, we compute Unique@Kand for the ﬁrst K= 1;000and K= 10;000valid molecules in the generated set. If the number of valid molecules is less than K, we compute uniqueness on all valid molecules. Validity measures how well the model captures explicit chemical constraints such as proper valence. Uniqueness checks that the model does not collapse to producing only a few typical molecules. Novelty is the fraction of the generated molecules that are not present in the training set. Low novelty indicates overﬁtting. Filters is the fraction of generated molecules that pass ﬁlters applied during dataset construction (see Section 5). While the generated molecules are often chemically valid, they may contain unwanted fragments: when constructing the training dataset, we removed molecules with such fragments and expect the models to avoid producing them. Fragment similarity (Frag) compares distributions of BRICS fragments [ 55] in generated and reference sets. Denoting cf(A)a number of times a substructure fappears in molecules from set A, and a set of fragments that appear in either Gor Ras F, the metric is deﬁned as a cosine similarity: Frag(G;R) =P f2F cf(G)cf(R) r P f2Fc2 f(G)r P f2Fc2 f(R): (1) If molecules in both sets have similar fragments, Frag metric is large. If some fragments are over- or underrepresented (or never appear) in the generated set, the metric will be lower. Limits of this metric are [0;1]. Scaffold similarity (Scaff) is similar to fragment similarity metric, but instead of fragments we com- pare frequencies of Bemis–Murcko scaffolds [ 56]. Bemis–Murcko scaffold contains all molecule’s ring structures and linker fragments connecting rings. We use RDKit implementation of this algorithm which additionally considers carbonyl groups attached to rings as part of a scaffold. Denoting cs(A) a number of times a scaffold sappears in molecules from set A, and a set of fragments that appear in either Gor Ras S, the metric is deﬁned as a cosine similarity: Frag(G;R) =P s2S cs(G)cs(R) r P s2Sc2s(G)r P s2Sc2s(R): (2) The purpose of this metric is to show how similar are the scaffolds present in generated and reference datasets. For example, if the model rarely produces a certain chemotype from a reference set, the metric will be low. Limits of this metric are [0;1]. Note that both fragment and scaffold similarities compare molecules at a substructure level. Hence, it is possible to have a similarity 1even when Gand Rcontain different molecules. Similarity to a nearest neighbor (SNN) is an average Tanimoto similarity T(m G;m R)(also known as the Jaccard index) between ﬁngerprints of a molecule m Gfrom the generated set Gand its nearest neighbor molecule m Rin the reference dataset R: SNN(G;R) =1 j Gj X m G2Gmax m R2RT(m G;m R); (3) In this work, we used standard Morgan (extended connectivity) ﬁngerprints [ 57] with radius 2and 1024 bits computed using RDKit library [ 58]. The resulting similarity metric can be interpreted as precision: if generated molecules are far from the manifold of the reference set, similarity to the nearest neighbor will be low. Limits of this metric are [0;1]. Internal diversity (Int Div p)[59] assesses the chemical diversity within the generated set of molecules G. Int Div p(G) = 1ps j Gj2X m1;m22GT(m1;m2)p: (4) This metric detects a common failure case of generative models—mode collapse. With mode collapse, the model produces a limited variety of samples, ignoring some areas of the chemical space. A higher value of this metric corresponds to higher diversity in the generated set. In the experiments, we report Int Div 1(G)and Int Div 2(G). Limits of this metric are [0;1]. Fréchet Chem Net Distance (FCD) [60] is calculated using activations of the penultimate layer of a deep neural network Chem Net trained to predict biological activities of drugs. We compute activations for canonical SMILES representations of molecules. These activations capture both chemical and biological properties of the compounds. For two sets of molecules Gand R, FCD is deﬁned as FCD(G;R) =kGRk2+ Tr G+ R2(GR)1=2 (5) whereG,Rare mean vectors and G,Rare full covariance matrices of activations for molecules from sets Gand Rrespectively. FCD correlates with other metrics. For example, if the gener- ated structures are not diverse enough (low Int Div p) or the model produces too many duplicates (low uniqueness), FCD will decrease, since the variance is smaller. We suggest using FCD for hyperparameter tuning and ﬁnal model selection. Values of this metric are non-negative, lower is better. Properties distribution is a useful tool for visually assessing the generated structures. To quanti- tatively compare the distributions in the generated and test sets, we compute a 1D Wasserstein-1 distance between property distributions of generated and test sets. We also visualize a kernel density estimation of these distributions in the Experiments section. We use the following four properties: •Molecular weight (MW) : the sum of atomic weights in a molecule. By plotting histograms of molecular weight for the generated and test sets, one can judge if a generated set is biased towards lighter or heavier molecules. •Log P : the octanol-water partition coefﬁcient, a ratio of a chemical’s concentration in the octanol phase to its concentration in the aqueous phase of a two-phase octanol/water system; computed with RDKit’s Crippen [61] estimation. •Synthetic Accessibility Score (SA) : a heuristic estimate of how hard (10) or how easy (1) it is to synthesize a given molecule. SA score is based on a combination of the molecule’s fragments contributions [ 62]. Note that SA score does not adequately assess up-to-date chemical structures, but it is useful for assessing distribution learning models. •Quantitative Estimation of Drug-likeness (QED) : a[0;1]value estimating how likely a molecule is a viable candidate for a drug. QED is meant to capture the abstract notion of aesthetics in medicinal chemistry [ 63]. Similar to SA, descriptor limits in QED have been changing during the last decade and current limits may not cover latest drugs [64]. 5 Dataset The proposed dataset used for training and testing is based on the ZINC Clean Leads [ 65] collection which contains 4;591;276molecules with molecular weight in the range from 250to350Daltons, a number of rotatable bonds not greater than 7, and Xlog P [ 66] not greater then 3:5. Clean-leads dataset consists of structures suitable for identifying hit compounds and they are small enough to allow for further ADMET optimization of generated molecules [ 67]. We removed molecules containing charged atoms, atoms besides C, N, S, O, F, Cl, Br, H, or cycles larger than 8atoms. The molecules were ﬁltered via custom medicinal chemistry ﬁlters (MCFs) and PAINS ﬁlters [ 68]. We describe MCFs and discuss PAINS in Appendix A. We removed charged molecules to avoid ambiguity with tautomers and p H conditions. Note that in the initial set of molecules, functional groups were present in both ionized and unionized forms. The ﬁnal dataset contains 1;936;963molecules, with internal diversity Int Div 1= 0:857; it contains 448;854unique Bemis-Murcko [ 56] scaffolds and 58;315unique BRICS [ 55] fragments. We show example molecules in Figure 3 and a representative diverse subset in Appendix B. We provide recommended split into three non-intersecting parts: train ( 1;584;664molecules), test ( 176;075 molecules) and scaffold test ( 176;226molecules). The scaffold test set has all molecules containing a Bemis-Murcko scaffold from a random subset of scaffolds. Hence, scaffolds from the scaffold test set differ from scaffolds in both train and test sets. We use scaffold test split to assess whether a S ONH N OO NH NO N O OOH OO FFFNH2 O O O S NNN NO OO NHO O NNHO NN N NNFigure 3: Examples of molecules from MOSES dataset. model can produce novel scaffolds absent in the training set. The test set is a random subset of the remaining molecules in the dataset

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.